Incidental Mutation 'R8414:Epha6'
ID 652856
Institutional Source Beutler Lab
Gene Symbol Epha6
Ensembl Gene ENSMUSG00000055540
Gene Name Eph receptor A6
Synonyms m-ehk2, Hek12, Ehk2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8414 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 59653483-60605531 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 60005667 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 588 (R588S)
Ref Sequence ENSEMBL: ENSMUSP00000066734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068860]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000068860
AA Change: R588S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066734
Gene: ENSMUSG00000055540
AA Change: R588S

DomainStartEndE-ValueType
low complexity region 4 37 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
EPH_lbd 128 301 5.95e-125 SMART
Pfam:GCC2_GCC3 361 406 1.6e-8 PFAM
FN3 426 518 5.83e-3 SMART
FN3 537 618 2.19e-7 SMART
Pfam:EphA2_TM 644 722 1.8e-22 PFAM
TyrKc 725 1024 3.66e-122 SMART
SAM 1052 1119 1.24e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display discrete learning and memory deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik A T 8: 84,167,323 E373V probably damaging Het
9530053A07Rik T A 7: 28,142,733 C698S probably damaging Het
AA467197 T C 2: 122,638,317 Y33H probably damaging Het
Abcc10 T C 17: 46,312,347 R880G probably benign Het
Abcg2 T A 6: 58,669,236 Y246N probably benign Het
Abhd18 A G 3: 40,933,626 M302V probably benign Het
Ablim2 A G 5: 35,874,891 D568G possibly damaging Het
Alpk2 T C 18: 65,307,471 R284G possibly damaging Het
AU021092 T C 16: 5,216,785 Y191C probably damaging Het
Bdp1 T A 13: 100,064,477 T751S probably benign Het
Ccdc136 A G 6: 29,412,930 E438G probably damaging Het
Cul2 C A 18: 3,399,912 N15K probably benign Het
Eml2 C A 7: 19,179,295 Q73K probably damaging Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Fbxw28 C T 9: 109,326,536 W389* probably null Het
Gbp4 A T 5: 105,136,837 V62E probably benign Het
Gm30302 A G 13: 49,787,797 S56P probably damaging Het
Gtf2h1 C A 7: 46,815,344 T401K possibly damaging Het
Hif1a G T 12: 73,937,654 M294I probably benign Het
Irak2 A G 6: 113,686,942 N484S probably benign Het
Kcnj16 A G 11: 111,025,615 T368A probably benign Het
Kcnq1 G A 7: 143,363,666 G588D probably damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Nckap5 T G 1: 126,014,620 E1582D probably damaging Het
Nrip3 A G 7: 109,763,528 I183T possibly damaging Het
Olfr1222 A G 2: 89,125,714 F6L probably benign Het
Olfr979 T A 9: 40,000,945 H94L probably benign Het
Pcdha2 C T 18: 36,941,566 S750L probably damaging Het
Pik3r2 T C 8: 70,770,435 Y447C probably damaging Het
Poteg T C 8: 27,448,040 Y75H probably benign Het
Proser1 G C 3: 53,478,556 G620R probably damaging Het
Prpsap1 A T 11: 116,478,613 L164H probably damaging Het
Rfc3 A T 5: 151,644,916 V195E possibly damaging Het
Sarm1 A T 11: 78,487,968 V417D probably damaging Het
She A G 3: 89,831,867 T122A probably benign Het
Srpr A G 9: 35,214,837 E442G probably benign Het
Sult2a6 T A 7: 14,250,432 R124S probably damaging Het
Synm T C 7: 67,733,763 T1384A probably benign Het
Tenm3 A G 8: 48,293,509 V1087A probably damaging Het
Ticam1 T A 17: 56,271,340 I252L probably benign Het
Trbv31 C A 6: 41,557,763 D89Y possibly damaging Het
Trpc7 G A 13: 56,822,469 T434I probably benign Het
Tubgcp4 T A 2: 121,194,153 I603N probably benign Het
Ugt3a1 A G 15: 9,310,583 N317S possibly damaging Het
Vdac1 C T 11: 52,376,503 T77I possibly damaging Het
Vmn2r113 A T 17: 22,958,779 R846* probably null Het
Zc3h12d GCCC GCC 10: 7,839,971 probably null Het
Zranb2 G T 3: 157,546,675 R310S unknown Het
Other mutations in Epha6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Epha6 APN 16 59915962 missense probably damaging 1.00
IGL00849:Epha6 APN 16 60425111 missense possibly damaging 0.89
IGL00898:Epha6 APN 16 59775541 critical splice donor site probably null
IGL01353:Epha6 APN 16 60424895 missense probably damaging 1.00
IGL01409:Epha6 APN 16 59655737 nonsense probably null
IGL01577:Epha6 APN 16 59956926 missense possibly damaging 0.57
IGL01653:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01654:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01655:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01657:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01663:Epha6 APN 16 59775644 missense probably damaging 1.00
IGL01899:Epha6 APN 16 59839303 missense probably benign 0.05
IGL02272:Epha6 APN 16 59818937 missense probably damaging 1.00
IGL03265:Epha6 APN 16 60060231 splice site probably benign
IGL03333:Epha6 APN 16 59682688 missense probably damaging 1.00
rauwulfia UTSW 16 59682616 missense probably damaging 1.00
PIT4377001:Epha6 UTSW 16 60205552 missense probably damaging 0.98
R0505:Epha6 UTSW 16 60205732 missense possibly damaging 0.89
R1593:Epha6 UTSW 16 60424904 missense probably damaging 1.00
R1764:Epha6 UTSW 16 59775728 missense probably null 1.00
R1836:Epha6 UTSW 16 60205745 missense probably damaging 1.00
R2061:Epha6 UTSW 16 59655797 missense probably damaging 1.00
R2125:Epha6 UTSW 16 59682688 missense probably damaging 1.00
R2867:Epha6 UTSW 16 59960296 splice site probably null
R2867:Epha6 UTSW 16 59960296 splice site probably null
R3760:Epha6 UTSW 16 60220984 missense possibly damaging 0.70
R4305:Epha6 UTSW 16 60526520 splice site probably null
R4613:Epha6 UTSW 16 59666597 missense possibly damaging 0.80
R4818:Epha6 UTSW 16 59654063 missense probably damaging 0.99
R4832:Epha6 UTSW 16 59960413 missense probably damaging 0.98
R4895:Epha6 UTSW 16 59666555 missense probably benign 0.08
R5014:Epha6 UTSW 16 59666579 missense probably benign 0.00
R5316:Epha6 UTSW 16 59954720 missense probably damaging 0.99
R5403:Epha6 UTSW 16 59775570 missense probably damaging 1.00
R5417:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5418:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5678:Epha6 UTSW 16 59818979 missense probably damaging 1.00
R5775:Epha6 UTSW 16 59818994 missense possibly damaging 0.92
R5808:Epha6 UTSW 16 59682742 missense probably damaging 1.00
R6076:Epha6 UTSW 16 60205710 missense probably damaging 1.00
R6146:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6212:Epha6 UTSW 16 60425356 missense possibly damaging 0.77
R6242:Epha6 UTSW 16 59682662 missense probably damaging 1.00
R6503:Epha6 UTSW 16 60205621 missense possibly damaging 0.61
R6580:Epha6 UTSW 16 59682616 missense probably damaging 1.00
R6726:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6728:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6798:Epha6 UTSW 16 60605064 missense possibly damaging 0.53
R6798:Epha6 UTSW 16 60605065 missense possibly damaging 0.53
R6903:Epha6 UTSW 16 60526462 missense probably benign 0.00
R6999:Epha6 UTSW 16 60425170 missense possibly damaging 0.94
R7058:Epha6 UTSW 16 59682650 missense probably damaging 1.00
R7109:Epha6 UTSW 16 59682668 missense probably damaging 1.00
R7263:Epha6 UTSW 16 59775665 missense probably damaging 1.00
R7296:Epha6 UTSW 16 59915838 missense probably benign 0.00
R7343:Epha6 UTSW 16 59960430 missense probably damaging 0.98
R7443:Epha6 UTSW 16 59775625 missense possibly damaging 0.93
R7533:Epha6 UTSW 16 60205562 missense probably damaging 1.00
R7602:Epha6 UTSW 16 59775568 missense probably damaging 1.00
R7604:Epha6 UTSW 16 60205772 missense possibly damaging 0.89
R8321:Epha6 UTSW 16 59915954 missense probably damaging 1.00
R8794:Epha6 UTSW 16 60205672 missense probably benign 0.00
R8926:Epha6 UTSW 16 59839299 missense probably benign 0.11
R9166:Epha6 UTSW 16 60604875 missense probably benign 0.00
R9265:Epha6 UTSW 16 59655754 missense probably damaging 1.00
R9322:Epha6 UTSW 16 60424755 missense probably damaging 1.00
Z1188:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Z1189:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCATTTCACTTGAGCAGC -3'
(R):5'- CACCAGTGACCATGTATAGTTAAAG -3'

Sequencing Primer
(F):5'- TTGAGCAGCACATCCTTGAG -3'
(R):5'- TCATCCCATTGATAATTTCCCAAATC -3'
Posted On 2020-10-20