Incidental Mutation 'R6519:Glb1l'
ID520942
Institutional Source Beutler Lab
Gene Symbol Glb1l
Ensembl Gene ENSMUSG00000026200
Gene Namegalactosidase, beta 1-like
Synonyms4833408P15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R6519 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location75198236-75210813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75201056 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 406 (D406G)
Ref Sequence ENSEMBL: ENSMUSP00000136285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113623] [ENSMUST00000145459] [ENSMUST00000152233] [ENSMUST00000155716] [ENSMUST00000185448]
Predicted Effect probably benign
Transcript: ENSMUST00000113623
AA Change: D406G

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109253
Gene: ENSMUSG00000026200
AA Change: D406G

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Glyco_hydro_35 34 351 4.1e-123 PFAM
Pfam:Glyco_hydro_42 48 209 6.6e-12 PFAM
low complexity region 355 371 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143193
Predicted Effect probably benign
Transcript: ENSMUST00000145459
SMART Domains Protein: ENSMUSP00000135971
Gene: ENSMUSG00000026199

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
Blast:ZnF_C2H2 96 120 1e-9 BLAST
low complexity region 143 171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146713
Predicted Effect probably benign
Transcript: ENSMUST00000152233
SMART Domains Protein: ENSMUSP00000136163
Gene: ENSMUSG00000026199

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
Blast:ZnF_C2H2 96 120 6e-11 BLAST
low complexity region 143 171 N/A INTRINSIC
low complexity region 394 407 N/A INTRINSIC
low complexity region 425 451 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
Blast:ANK 515 545 2e-9 BLAST
ANK 556 585 6.81e-3 SMART
coiled coil region 628 681 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153584
Predicted Effect probably benign
Transcript: ENSMUST00000155716
AA Change: D406G

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136285
Gene: ENSMUSG00000026200
AA Change: D406G

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Glyco_hydro_35 34 351 4.2e-125 PFAM
Pfam:Glyco_hydro_42 48 209 6.6e-12 PFAM
low complexity region 355 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185448
SMART Domains Protein: ENSMUSP00000140820
Gene: ENSMUSG00000026200

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Glyco_hydro_35 34 188 1.6e-71 PFAM
Pfam:Glyco_hydro_42 48 188 6.4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186148
Predicted Effect unknown
Transcript: ENSMUST00000186173
AA Change: D310G
Predicted Effect probably benign
Transcript: ENSMUST00000189663
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.7%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,613,670 I53T probably damaging Het
Adgrv1 C T 13: 81,567,343 D909N probably benign Het
Ahdc1 T C 4: 133,064,768 Y1107H possibly damaging Het
Aldob A T 4: 49,543,835 V49E probably damaging Het
Apol6 T A 15: 77,051,276 Y248* probably null Het
Apol7b T A 15: 77,423,348 T316S probably benign Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
BC037034 A G 5: 138,261,848 S344P probably damaging Het
Brca2 A C 5: 150,540,979 T1403P probably damaging Het
Casc4 T C 2: 121,906,737 V141A probably benign Het
Cblc T C 7: 19,792,863 Y148C probably damaging Het
Cct7 C A 6: 85,462,150 Q149K probably benign Het
Cd53 T A 3: 106,762,145 H179L probably benign Het
Cyp2b19 A G 7: 26,759,111 T84A probably benign Het
Cyp3a41a A G 5: 145,715,498 C64R probably damaging Het
Dclre1c T C 2: 3,429,329 Y75H probably damaging Het
Dhx35 A T 2: 158,831,710 I354F probably damaging Het
Diaph3 T C 14: 86,966,335 N629S probably damaging Het
Dnase1 A T 16: 4,038,589 S132C probably damaging Het
Dnttip2 T C 3: 122,275,471 S112P probably benign Het
Eif4g3 C A 4: 137,994,008 P48T probably benign Het
Fat4 A T 3: 39,002,871 T4239S probably benign Het
Fbn2 A G 18: 58,063,575 V1419A possibly damaging Het
Ghitm A C 14: 37,125,247 M290R probably damaging Het
Glipr1l1 C A 10: 112,062,248 A86D probably benign Het
Grm7 C T 6: 111,207,752 A348V probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hdac2 T A 10: 36,989,256 N155K probably damaging Het
Hus1b A G 13: 30,946,947 I243T probably benign Het
Kcnab2 T C 4: 152,411,993 T65A probably damaging Het
Lasp1 T A 11: 97,815,557 probably null Het
Lrch3 G A 16: 32,994,997 probably benign Het
Ltb4r2 C T 14: 55,762,981 T353M probably benign Het
Macf1 A G 4: 123,472,325 M1316T probably benign Het
Msr1 G A 8: 39,624,221 T116I probably benign Het
Nlrp5 A G 7: 23,417,918 I356V probably benign Het
Npy C T 6: 49,823,689 S31F possibly damaging Het
Nsd3 C T 8: 25,662,939 P432S probably damaging Het
Nup160 A C 2: 90,718,217 R1037S probably damaging Het
Olfr284 C T 15: 98,340,048 G314R probably benign Het
Olfr32 A T 2: 90,138,812 I109N possibly damaging Het
Olfr533 T A 7: 140,466,545 S115T probably benign Het
Pcx A G 19: 4,602,211 E108G possibly damaging Het
Pecam1 A T 11: 106,699,642 M102K probably benign Het
Pgd G T 4: 149,150,886 Y433* probably null Het
Pkd1l3 A G 8: 109,628,772 E744G probably benign Het
Rb1 A G 14: 73,298,063 I118T probably benign Het
Rdh11 T A 12: 79,182,815 H228L probably damaging Het
Rnf44 C T 13: 54,681,786 R340Q probably damaging Het
Rtraf A G 14: 19,819,930 V88A possibly damaging Het
Sigmar1 T C 4: 41,739,380 T185A possibly damaging Het
Thsd1 A G 8: 22,259,065 R590G probably damaging Het
Trbv19 T C 6: 41,178,639 probably benign Het
Txnrd3 T C 6: 89,654,423 probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xpnpep1 T C 19: 53,011,844 N192D possibly damaging Het
Zfp955b T A 17: 33,302,077 S173R possibly damaging Het
Zranb1 T A 7: 132,950,128 C195* probably null Het
Other mutations in Glb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Glb1l APN 1 75201238 missense probably damaging 0.99
IGL01477:Glb1l APN 1 75208706 missense probably damaging 1.00
R0408:Glb1l UTSW 1 75208835 missense probably damaging 1.00
R0620:Glb1l UTSW 1 75199720 missense probably damaging 1.00
R1639:Glb1l UTSW 1 75199601 missense probably benign 0.16
R1842:Glb1l UTSW 1 75200460 missense probably damaging 0.96
R2508:Glb1l UTSW 1 75201829 missense probably damaging 0.99
R2920:Glb1l UTSW 1 75209190 missense probably benign
R3439:Glb1l UTSW 1 75202620 missense probably damaging 1.00
R4096:Glb1l UTSW 1 75209440 start codon destroyed probably benign 0.01
R4517:Glb1l UTSW 1 75208703 missense probably damaging 1.00
R4829:Glb1l UTSW 1 75200350 missense probably damaging 0.96
R4851:Glb1l UTSW 1 75208884 unclassified probably benign
R4859:Glb1l UTSW 1 75200319 splice site probably benign
R4951:Glb1l UTSW 1 75208375 missense probably damaging 1.00
R6163:Glb1l UTSW 1 75201407 missense probably benign
R6693:Glb1l UTSW 1 75209101 missense probably damaging 1.00
R6713:Glb1l UTSW 1 75202417 missense probably benign 0.02
R6833:Glb1l UTSW 1 75201753 missense possibly damaging 0.93
R6834:Glb1l UTSW 1 75201753 missense possibly damaging 0.93
R7068:Glb1l UTSW 1 75202737 missense probably damaging 1.00
R7453:Glb1l UTSW 1 75202706 missense probably damaging 1.00
R7694:Glb1l UTSW 1 75201792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTATAACCGGGGCAGACAG -3'
(R):5'- TTGCCATTGACCTTTGAGGCTG -3'

Sequencing Primer
(F):5'- TTAACATTAAAGCTGAAGGGTGC -3'
(R):5'- CCATTGACCTTTGAGGCTGTTAAAC -3'
Posted On2018-06-06