Incidental Mutation 'R6526:Atp11a'
ID521864
Institutional Source Beutler Lab
Gene Symbol Atp11a
Ensembl Gene ENSMUSG00000031441
Gene NameATPase, class VI, type 11A
SynonymsIh, 4930558F19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6526 (G1)
Quality Score189.009
Status Validated
Chromosome8
Chromosomal Location12757014-12868728 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12864999 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1139 (L1139P)
Ref Sequence ENSEMBL: ENSMUSP00000088779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033818] [ENSMUST00000091237] [ENSMUST00000132974]
Predicted Effect probably benign
Transcript: ENSMUST00000033818
SMART Domains Protein: ENSMUSP00000033818
Gene: ENSMUSG00000031441

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 25 96 3.6e-26 PFAM
Pfam:E1-E2_ATPase 101 377 1.1e-12 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:HAD 411 837 9.9e-21 PFAM
Pfam:Cation_ATPase 476 589 2.5e-11 PFAM
Pfam:PhoLip_ATPase_C 854 1106 2e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091237
AA Change: L1139P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088779
Gene: ENSMUSG00000031441
AA Change: L1139P

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 25 96 7.3e-26 PFAM
Pfam:E1-E2_ATPase 101 377 2.7e-12 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:HAD 411 837 1.9e-20 PFAM
Pfam:Cation_ATPase 476 589 7.4e-11 PFAM
Pfam:PhoLip_ATPase_C 854 1106 4.5e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131804
SMART Domains Protein: ENSMUSP00000121567
Gene: ENSMUSG00000031441

DomainStartEndE-ValueType
SCOP:d1eula_ 6 53 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132974
SMART Domains Protein: ENSMUSP00000117091
Gene: ENSMUSG00000031441

DomainStartEndE-ValueType
Pfam:Hydrolase_like2 1 42 2.6e-8 PFAM
Pfam:HAD 17 290 4.1e-14 PFAM
Pfam:Hydrolase 20 293 7.7e-13 PFAM
transmembrane domain 420 442 N/A INTRINSIC
transmembrane domain 454 476 N/A INTRINSIC
transmembrane domain 491 513 N/A INTRINSIC
transmembrane domain 520 542 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139545
Predicted Effect probably benign
Transcript: ENSMUST00000143359
SMART Domains Protein: ENSMUSP00000114312
Gene: ENSMUSG00000031441

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_C 1 98 2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145372
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral membrane ATPase. The encoded protein is probably phosphorylated in its intermediate state and likely drives the transport of ions such as calcium across membranes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,172 probably null Het
Abcc3 C T 11: 94,359,372 G975D probably benign Het
Abhd13 G A 8: 9,987,777 G125S probably damaging Het
Ache T A 5: 137,290,644 L204Q probably damaging Het
Acnat2 A G 4: 49,383,497 S19P probably benign Het
Adprh A G 16: 38,447,276 Y216H probably benign Het
Anapc1 T A 2: 128,672,135 K429* probably null Het
Anxa13 T C 15: 58,344,957 noncoding transcript Het
Aprt A C 8: 122,576,816 L6W probably damaging Het
Arhgef15 T C 11: 68,949,994 T569A probably damaging Het
Atp2b4 A G 1: 133,711,729 S1136P probably damaging Het
B9d1 T A 11: 61,509,097 Y90* probably null Het
Btla G A 16: 45,239,094 A54T probably damaging Het
Cd63 T C 10: 128,911,489 V35A probably benign Het
Chek2 T C 5: 110,848,690 F173L probably damaging Het
Cntnap3 T A 13: 64,781,888 N499I possibly damaging Het
Cog4 T C 8: 110,881,786 L738P probably damaging Het
Cops6 T C 5: 138,163,900 probably null Het
Cpeb1 T A 7: 81,361,669 I175F probably benign Het
Cyp3a16 C T 5: 145,455,895 D174N probably benign Het
Dnah6 T G 6: 73,074,704 I2984L probably benign Het
Dock10 A T 1: 80,586,351 I540N probably damaging Het
Elf5 A G 2: 103,439,233 Y53C probably damaging Het
Elmod2 T C 8: 83,319,457 T164A probably damaging Het
Epn3 A G 11: 94,494,932 probably null Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Gm11115 T A 5: 88,154,050 probably null Het
Gm13103 A G 4: 143,852,814 D323G probably damaging Het
Golga3 T A 5: 110,204,895 I884N probably damaging Het
Gria2 A T 3: 80,692,469 F703I probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtpbp2 A T 17: 46,164,111 probably null Het
Herc2 T C 7: 56,157,330 S2419P probably damaging Het
Ikbkap T C 4: 56,798,812 probably null Het
Inpp5d T C 1: 87,676,250 probably benign Het
Kdm2b C A 5: 122,961,469 V136F probably damaging Het
Klra2 T A 6: 131,221,876 D234V probably benign Het
Lct A T 1: 128,300,478 S1093T probably benign Het
March9 A G 10: 127,056,689 L310P probably benign Het
Morc1 G T 16: 48,587,124 E668* probably null Het
Mum1 A G 10: 80,232,279 T86A probably benign Het
Nbas A T 12: 13,405,425 L1213F probably damaging Het
Neto1 A G 18: 86,498,748 T397A possibly damaging Het
Oit3 A G 10: 59,429,640 C268R probably damaging Het
Olfr476 A G 7: 107,967,462 T22A probably benign Het
Pcx T C 19: 4,604,495 F312L probably benign Het
Pitx2 T C 3: 129,214,783 probably null Het
Pkhd1l1 G A 15: 44,498,089 probably null Het
Polr1a C A 6: 71,929,443 D414E possibly damaging Het
Prkch T C 12: 73,702,775 Y381H probably damaging Het
Ptger3 T A 3: 157,567,502 V162E probably damaging Het
Ptgr2 T G 12: 84,313,952 M332R probably damaging Het
Ptprq G T 10: 107,542,653 S2009* probably null Het
Rangrf C T 11: 68,973,688 G11R probably damaging Het
Rbl2 A T 8: 91,096,839 Q465L probably benign Het
Rhbdd1 A T 1: 82,340,659 M88L probably benign Het
Setd2 G A 9: 110,532,717 M13I probably benign Het
Sirpb1a T C 3: 15,379,020 Y384C probably damaging Het
Slc13a1 C T 6: 24,097,612 G439S probably damaging Het
Slc41a1 T A 1: 131,841,149 I239N probably damaging Het
Slit2 T A 5: 48,304,167 C1502S probably damaging Het
Slit3 G A 11: 35,661,292 E888K probably benign Het
Srrm3 G T 5: 135,835,234 R62L probably damaging Het
Synm A G 7: 67,735,583 V777A possibly damaging Het
Trmt13 T A 3: 116,592,215 N31I probably damaging Het
Trpm8 G A 1: 88,361,998 E893K probably damaging Het
Uqcc1 A G 2: 155,851,423 F197S probably damaging Het
Vmn1r67 T A 7: 10,447,671 N287K probably benign Het
Vmn2r44 A T 7: 8,378,099 M265K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xdh C A 17: 73,900,551 C937F probably damaging Het
Zfp846 T A 9: 20,593,871 N342K probably benign Het
Other mutations in Atp11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Atp11a APN 8 12844609 missense probably damaging 1.00
IGL01397:Atp11a APN 8 12812321 missense probably damaging 1.00
IGL01712:Atp11a APN 8 12851138 missense probably benign 0.11
IGL02113:Atp11a APN 8 12865048 missense probably benign
IGL02449:Atp11a APN 8 12757358 splice site probably null
IGL02550:Atp11a APN 8 12816997 missense possibly damaging 0.72
IGL03099:Atp11a APN 8 12827462 missense possibly damaging 0.52
R0139:Atp11a UTSW 8 12846054 missense probably benign 0.00
R0265:Atp11a UTSW 8 12856930 splice site probably benign
R0294:Atp11a UTSW 8 12827524 missense probably benign 0.03
R0331:Atp11a UTSW 8 12816953 nonsense probably null
R0582:Atp11a UTSW 8 12831214 missense probably benign 0.10
R1033:Atp11a UTSW 8 12828555 missense probably damaging 1.00
R1213:Atp11a UTSW 8 12842859 missense probably benign 0.04
R1551:Atp11a UTSW 8 12812340 missense probably damaging 1.00
R1648:Atp11a UTSW 8 12847495 missense probably damaging 1.00
R1752:Atp11a UTSW 8 12813094 missense probably damaging 1.00
R1826:Atp11a UTSW 8 12846154 missense probably damaging 1.00
R1887:Atp11a UTSW 8 12812324 missense probably damaging 1.00
R2079:Atp11a UTSW 8 12857902 missense probably damaging 1.00
R2106:Atp11a UTSW 8 12835228 missense probably benign
R2319:Atp11a UTSW 8 12847505 missense probably damaging 1.00
R2966:Atp11a UTSW 8 12847853 unclassified probably null
R4021:Atp11a UTSW 8 12842938 missense probably benign 0.01
R4183:Atp11a UTSW 8 12816990 missense possibly damaging 0.94
R4640:Atp11a UTSW 8 12828434 splice site probably benign
R4705:Atp11a UTSW 8 12813118 missense probably damaging 1.00
R5354:Atp11a UTSW 8 12806753 missense probably damaging 1.00
R5777:Atp11a UTSW 8 12832522 missense probably damaging 0.99
R6152:Atp11a UTSW 8 12846100 missense probably damaging 0.97
R6171:Atp11a UTSW 8 12832663 missense probably damaging 1.00
R6197:Atp11a UTSW 8 12846099 missense probably benign 0.01
R6335:Atp11a UTSW 8 12859481 critical splice donor site probably null
R6792:Atp11a UTSW 8 12861939 unclassified probably benign
R6923:Atp11a UTSW 8 12856949 missense probably damaging 0.99
R6959:Atp11a UTSW 8 12820467 missense probably damaging 1.00
R7297:Atp11a UTSW 8 12806774 critical splice donor site probably null
R7499:Atp11a UTSW 8 12832575 missense probably benign 0.01
R7606:Atp11a UTSW 8 12844427 missense probably damaging 1.00
R7844:Atp11a UTSW 8 12851039 missense possibly damaging 0.68
R7927:Atp11a UTSW 8 12851039 missense possibly damaging 0.68
X0017:Atp11a UTSW 8 12826323 critical splice acceptor site probably null
X0022:Atp11a UTSW 8 12847794 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGATGGGCCCACTTACCTAC -3'
(R):5'- GGTACCCAAGAACAGAGCTCTC -3'

Sequencing Primer
(F):5'- CCCTCAGGGTGATGTAGTGGTC -3'
(R):5'- GCTCTCAGCGGCTGGGG -3'
Posted On2018-06-06