Mutagenetix > Incidental Mutation

Incidental Mutation 'R6593:Neto2'

523475

Institutional Source

Beutler Lab

Gene Symbol

Neto2

Ensembl Gene

ENSMUSG00000036902

Gene Name

neuropilin (NRP) and tolloid (TLL)-like 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.166) question?

Stock #

R6593 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85636588-85700924 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85669546 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 192 (S192P)

Ref Sequence

ENSEMBL: ENSMUSP00000105308 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109686] [ENSMUST00000209479] [ENSMUST00000216286]

AlphaFold

Q8BNJ6

Predicted Effect

probably damaging
Transcript: ENSMUST00000109686
AA Change: S192P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105308
Gene: ENSMUSG00000036902
AA Change: S192P

Domain	Start	End	E-Value	Type
transmembrane domain	38	60	N/A	INTRINSIC
CUB	80	194	2.56e-40	SMART
CUB	205	320	9.11e-5	SMART
LDLa	324	361	5.73e-5	SMART
transmembrane domain	374	396	N/A	INTRINSIC
coiled coil region	432	460	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209259

Predicted Effect

probably damaging
Transcript: ENSMUST00000209479
AA Change: S157P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215046

Predicted Effect

possibly damaging
Transcript: ENSMUST00000216286
AA Change: S157P

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)

Coding Region Coverage

1x: 99.8%
3x: 99.2%
10x: 96.6%
20x: 89.6%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in rats encodes a protein that modulates glutamate signaling in the brain by regulating kainate receptor function. Expression of this gene may be a biomarker for proliferating infantile hemangiomas. A pseudogene of this gene is located on the long arm of chromosome 8. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null mutation show normal brain morphology and kainate receptor mediated excitatory postsynaptic currents. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	C	A	5: 8,853,491	N1047K	probably benign	Het
AI597479	C	A	1: 43,111,248	Q173K	probably damaging	Het
Arhgef10	T	C	8: 14,962,522	L282P	probably damaging	Het
Arhgef10	T	C	8: 14,962,564	I296T	possibly damaging	Het
Atg2b	A	G	12: 105,644,848	S1275P	probably damaging	Het
Ccdc114	T	A	7: 45,947,384	D378E	probably damaging	Het
Cep290	T	C	10: 100,508,776	M485T	probably benign	Het
Clca3a2	A	G	3: 144,808,577		probably null	Het
Clcn6	C	T	4: 148,010,769	S731N	probably benign	Het
Clic6	A	G	16: 92,528,117	I388V	possibly damaging	Het
Cpsf4l	G	T	11: 113,709,366		probably benign	Het
Ddx58	T	C	4: 40,226,651	I169V	probably benign	Het
Dlg5	G	A	14: 24,150,652	H1350Y	probably benign	Het
Dnase2b	T	C	3: 146,586,911	Y169C	probably damaging	Het
Elavl3	C	T	9: 22,018,547	V354M	possibly damaging	Het
Farp2	A	C	1: 93,569,940	I231L	possibly damaging	Het
Gcc2	T	A	10: 58,271,507	M755K	probably damaging	Het
Gpr88	T	C	3: 116,252,624	T13A	unknown	Het
Gstm3	T	A	3: 107,968,195	N40Y	probably benign	Het
Krtap5-2	A	T	7: 142,174,960	C328S	unknown	Het
Lpar1	A	T	4: 58,486,605	V222E	probably damaging	Het
Olfr665	C	T	7: 104,881,433	T242I	probably damaging	Het
Pcdhgb1	G	T	18: 37,682,081	D542Y	probably damaging	Het
Phldb2	G	A	16: 45,825,427	Q264*	probably null	Het
Ptgs2	G	A	1: 150,101,033	D6N	possibly damaging	Het
Rasef	G	T	4: 73,745,090	H167N	probably damaging	Het
Rbbp4	A	G	4: 129,322,375	L193S	probably damaging	Het
Sec24d	T	C	3: 123,353,412	F673S	probably damaging	Het
Slc9b1	T	C	3: 135,357,458	M1T	probably null	Het
Stra6	A	G	9: 58,151,979	T542A	probably benign	Het
Stt3b	T	C	9: 115,252,511	Y569C	probably damaging	Het
Traf3ip1	A	G	1: 91,527,695	K626R	possibly damaging	Het
Washc2	T	A	6: 116,259,249	I1227N	probably damaging	Het
Xpo7	G	A	14: 70,682,362	A671V	probably damaging	Het
Zfp799	A	G	17: 32,819,790	Y501H	probably damaging	Het

Other mutations in Neto2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01705:Neto2	APN	8	85641003	missense	probably damaging	1.00
IGL01938:Neto2	APN	8	85690855	missense	probably benign	0.00
IGL02238:Neto2	APN	8	85669663	missense	probably damaging	0.99
IGL02605:Neto2	APN	8	85663435	splice site	probably benign
IGL02813:Neto2	APN	8	85690886	missense	probably benign
R0138:Neto2	UTSW	8	85641044	missense	possibly damaging	0.72
R1934:Neto2	UTSW	8	85670404	missense	possibly damaging	0.96
R2402:Neto2	UTSW	8	85690912	missense	probably benign	0.00
R2423:Neto2	UTSW	8	85669767	missense	probably damaging	1.00
R3821:Neto2	UTSW	8	85663295	nonsense	probably null
R3822:Neto2	UTSW	8	85663295	nonsense	probably null
R3883:Neto2	UTSW	8	85663265	missense	probably damaging	1.00
R3939:Neto2	UTSW	8	85674118	missense	probably damaging	0.99
R3940:Neto2	UTSW	8	85674118	missense	probably damaging	0.99
R3941:Neto2	UTSW	8	85674118	missense	probably damaging	0.99
R4433:Neto2	UTSW	8	85641083	missense	probably damaging	1.00
R4668:Neto2	UTSW	8	85641062	missense	probably damaging	1.00
R4675:Neto2	UTSW	8	85669704	missense	probably damaging	1.00
R4908:Neto2	UTSW	8	85669764	missense	probably damaging	0.99
R5459:Neto2	UTSW	8	85670483	missense	probably benign	0.35
R5471:Neto2	UTSW	8	85640760	missense	probably benign	0.41
R5544:Neto2	UTSW	8	85647877	missense	possibly damaging	0.94
R5571:Neto2	UTSW	8	85640544	missense	probably damaging	1.00
R6083:Neto2	UTSW	8	85640585	missense	probably benign	0.00
R6339:Neto2	UTSW	8	85640558	missense	probably benign	0.33
R6381:Neto2	UTSW	8	85642509	missense	probably damaging	0.99
R6572:Neto2	UTSW	8	85670404	missense	possibly damaging	0.96
R6662:Neto2	UTSW	8	85663215	missense	probably damaging	1.00
R6881:Neto2	UTSW	8	85640556	missense	probably damaging	1.00
R6950:Neto2	UTSW	8	85670443	missense	probably damaging	1.00
R7121:Neto2	UTSW	8	85670391	splice site	probably null
R7754:Neto2	UTSW	8	85669700	missense	probably damaging	0.98
R7755:Neto2	UTSW	8	85669656	missense	probably damaging	1.00
R8682:Neto2	UTSW	8	85640666	missense	probably benign	0.01
R9326:Neto2	UTSW	8	85642434	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAATGGTATATGGCCTATTGTTCC -3'
(R):5'- ATTCGAATGTCGGTTTGATCACTTG -3'

Sequencing Primer
(F):5'- TGAGCCACAATGTAGTTACTGG -3'
(R):5'- TTGATCACTTGGAAATTCGAGACGG -3'

Posted On

2018-06-22