Mutagenetix > Incidental Mutation

Incidental Mutation 'R3821:Neto2'

274923

Institutional Source

Beutler Lab

Gene Symbol

Neto2

Ensembl Gene

ENSMUSG00000036902

Gene Name

neuropilin (NRP) and tolloid (TLL)-like 2

Synonyms

MMRRC Submission

040883-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.166) question?

Stock #

R3821 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85636588-85700924 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 85663295 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 180 (E180*)

Ref Sequence

ENSEMBL: ENSMUSP00000150062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109686] [ENSMUST00000209479] [ENSMUST00000216286]

AlphaFold

Q8BNJ6

Predicted Effect

probably null
Transcript: ENSMUST00000109686
AA Change: E208*

SMART Domains

Protein: ENSMUSP00000105308
Gene: ENSMUSG00000036902
AA Change: E208*

Domain	Start	End	E-Value	Type
transmembrane domain	38	60	N/A	INTRINSIC
CUB	80	194	2.56e-40	SMART
CUB	205	320	9.11e-5	SMART
LDLa	324	361	5.73e-5	SMART
transmembrane domain	374	396	N/A	INTRINSIC
coiled coil region	432	460	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209259

Predicted Effect

probably null
Transcript: ENSMUST00000209479
AA Change: E173*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215046

Predicted Effect

probably null
Transcript: ENSMUST00000216286
AA Change: E180*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in rats encodes a protein that modulates glutamate signaling in the brain by regulating kainate receptor function. Expression of this gene may be a biomarker for proliferating infantile hemangiomas. A pseudogene of this gene is located on the long arm of chromosome 8. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null mutation show normal brain morphology and kainate receptor mediated excitatory postsynaptic currents. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aarsd1	T	A	11: 101,411,145	I332F	probably damaging	Het
Abcd2	C	T	15: 91,174,705	G512D	probably damaging	Het
Acpp	G	T	9: 104,324,717	Q76K	probably damaging	Het
Adamtsl3	G	T	7: 82,606,479		probably benign	Het
Alox8	T	A	11: 69,186,482	I481F	probably damaging	Het
Anp32e	A	T	3: 95,934,869	I100L	probably benign	Het
Arpin	G	A	7: 79,929,660	R72C	probably damaging	Het
C6	A	G	15: 4,789,584	E466G	probably benign	Het
Ccdc13	C	A	9: 121,831,019	L76F	probably damaging	Het
Cd44	T	C	2: 102,901,393		probably null	Het
Clgn	A	G	8: 83,420,477	I353V	probably null	Het
Cnot6	A	T	11: 49,689,172	S98T	probably benign	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Cramp1l	G	A	17: 24,974,782	T908I	probably damaging	Het
Dnah9	C	A	11: 65,851,003		probably null	Het
Ehd3	A	T	17: 73,827,395	I250F	probably benign	Het
Eml2	T	C	7: 19,202,986	V555A	possibly damaging	Het
Erbb4	A	G	1: 68,305,913	S550P	probably damaging	Het
Fam196b	T	C	11: 34,403,007	S350P	probably benign	Het
Fchsd1	A	G	18: 37,969,457		probably benign	Het
Flad1	T	A	3: 89,411,187	I20F	probably damaging	Het
Frem2	A	T	3: 53,652,415	L1557Q	probably damaging	Het
Gbf1	T	C	19: 46,264,807	I506T	probably damaging	Het
Gm20730	C	T	6: 43,081,722	S52N	probably benign	Het
Hoxc9	A	G	15: 102,982,164	K171R	probably benign	Het
Hscb	A	T	5: 110,836,328	D52E	probably damaging	Het
Htr1b	A	T	9: 81,632,434	I40N	probably benign	Het
Ido2	T	C	8: 24,533,755	I356V	probably benign	Het
Irs1	T	C	1: 82,290,049	T149A	probably benign	Het
Itgam	A	G	7: 128,112,286		probably null	Het
Itpr2	A	T	6: 146,417,726	H244Q	probably damaging	Het
Kcnma1	A	G	14: 23,367,611	I846T	probably damaging	Het
Kdm3a	A	T	6: 71,611,677	D449E	probably benign	Het
Lama1	C	A	17: 67,779,046		probably null	Het
Lhfpl4	A	G	6: 113,194,108	V39A	probably benign	Het
Marf1	A	T	16: 14,142,554	L542Q	probably damaging	Het
Mns1	A	G	9: 72,439,448	E71G	probably damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mrpl19	C	A	6: 81,962,006	E272*	probably null	Het
Ncoa6	T	A	2: 155,406,938	N1482I	probably damaging	Het
Olfr435	A	G	6: 43,201,670	T9A	probably benign	Het
Pcdhga10	A	G	18: 37,747,942	N252S	probably damaging	Het
Pcdhgb7	C	A	18: 37,752,233	T152K	possibly damaging	Het
Ptprb	G	T	10: 116,350,074	R1678L	probably benign	Het
Ptprg	A	T	14: 12,226,375	I1323L	probably benign	Het
Rab40b	T	A	11: 121,358,048	N127I	probably damaging	Het
Scn10a	A	G	9: 119,638,633	C814R	probably benign	Het
Sdhb	C	T	4: 140,979,088	R279*	probably null	Het
Shroom4	C	T	X: 6,624,222	Q1165*	probably null	Het
Slc17a4	C	T	13: 23,901,769	R387H	probably benign	Het
Slc20a2	A	G	8: 22,538,902	I130V	probably benign	Het
Slitrk3	T	C	3: 73,049,216	Y741C	possibly damaging	Het
Tas1r1	G	T	4: 152,034,681	L144I	probably benign	Het
Tenm2	A	T	11: 36,024,320	I2129N	probably damaging	Het
Tmbim1	A	G	1: 74,293,930	V92A	probably damaging	Het
Tmem131	T	A	1: 36,808,396	H1207L	probably damaging	Het
Tmem209	G	T	6: 30,505,960	P116T	probably damaging	Het
Tmem8b	C	A	4: 43,689,745	H800N	probably damaging	Het
Tnfsf8	A	G	4: 63,860,890	V57A	probably benign	Het
Topaz1	A	G	9: 122,797,783	D1492G	possibly damaging	Het
Trank1	G	A	9: 111,378,819	G1711R	probably damaging	Het
Trpc6	A	T	9: 8,610,278	D249V	probably damaging	Het
Ubr3	G	A	2: 69,993,813		probably null	Het
Ufc1	A	G	1: 171,289,599		probably benign	Het
Unc5cl	T	C	17: 48,459,973	L125P	possibly damaging	Het
Usb1	G	A	8: 95,333,433	S57N	probably benign	Het
Wdfy1	A	G	1: 79,706,300	S373P	probably benign	Het
Zfp618	G	A	4: 63,133,564	A861T	probably benign	Het
Zfp831	T	C	2: 174,644,023	S164P	possibly damaging	Het

Other mutations in Neto2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01705:Neto2	APN	8	85641003	missense	probably damaging	1.00
IGL01938:Neto2	APN	8	85690855	missense	probably benign	0.00
IGL02238:Neto2	APN	8	85669663	missense	probably damaging	0.99
IGL02605:Neto2	APN	8	85663435	splice site	probably benign
IGL02813:Neto2	APN	8	85690886	missense	probably benign
R0138:Neto2	UTSW	8	85641044	missense	possibly damaging	0.72
R1934:Neto2	UTSW	8	85670404	missense	possibly damaging	0.96
R2402:Neto2	UTSW	8	85690912	missense	probably benign	0.00
R2423:Neto2	UTSW	8	85669767	missense	probably damaging	1.00
R3822:Neto2	UTSW	8	85663295	nonsense	probably null
R3883:Neto2	UTSW	8	85663265	missense	probably damaging	1.00
R3939:Neto2	UTSW	8	85674118	missense	probably damaging	0.99
R3940:Neto2	UTSW	8	85674118	missense	probably damaging	0.99
R3941:Neto2	UTSW	8	85674118	missense	probably damaging	0.99
R4433:Neto2	UTSW	8	85641083	missense	probably damaging	1.00
R4668:Neto2	UTSW	8	85641062	missense	probably damaging	1.00
R4675:Neto2	UTSW	8	85669704	missense	probably damaging	1.00
R4908:Neto2	UTSW	8	85669764	missense	probably damaging	0.99
R5459:Neto2	UTSW	8	85670483	missense	probably benign	0.35
R5471:Neto2	UTSW	8	85640760	missense	probably benign	0.41
R5544:Neto2	UTSW	8	85647877	missense	possibly damaging	0.94
R5571:Neto2	UTSW	8	85640544	missense	probably damaging	1.00
R6083:Neto2	UTSW	8	85640585	missense	probably benign	0.00
R6339:Neto2	UTSW	8	85640558	missense	probably benign	0.33
R6381:Neto2	UTSW	8	85642509	missense	probably damaging	0.99
R6572:Neto2	UTSW	8	85670404	missense	possibly damaging	0.96
R6593:Neto2	UTSW	8	85669546	missense	probably damaging	1.00
R6662:Neto2	UTSW	8	85663215	missense	probably damaging	1.00
R6881:Neto2	UTSW	8	85640556	missense	probably damaging	1.00
R6950:Neto2	UTSW	8	85670443	missense	probably damaging	1.00
R7121:Neto2	UTSW	8	85670391	splice site	probably null
R7754:Neto2	UTSW	8	85669700	missense	probably damaging	0.98
R7755:Neto2	UTSW	8	85669656	missense	probably damaging	1.00
R8682:Neto2	UTSW	8	85640666	missense	probably benign	0.01
R9326:Neto2	UTSW	8	85642434	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCATAGGTGCCCAATACAGTAAAGG -3'
(R):5'- AGCTCAGTACCAATGACTTTCTCC -3'

Sequencing Primer
(F):5'- GCCCAATACAGTAAAGGAAACAAAAG -3'
(R):5'- CTCTCTTTTGTTACAGATCCAGAC -3'

Posted On

2015-04-02