Incidental Mutation 'R4433:Neto2'
ID328702
Institutional Source Beutler Lab
Gene Symbol Neto2
Ensembl Gene ENSMUSG00000036902
Gene Nameneuropilin (NRP) and tolloid (TLL)-like 2
Synonyms
MMRRC Submission 041147-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R4433 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location85636588-85700924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85641083 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 337 (T337I)
Ref Sequence ENSEMBL: ENSMUSP00000148172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109686] [ENSMUST00000209479] [ENSMUST00000216286]
Predicted Effect probably damaging
Transcript: ENSMUST00000109686
AA Change: T372I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105308
Gene: ENSMUSG00000036902
AA Change: T372I

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
CUB 80 194 2.56e-40 SMART
CUB 205 320 9.11e-5 SMART
LDLa 324 361 5.73e-5 SMART
transmembrane domain 374 396 N/A INTRINSIC
coiled coil region 432 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209259
Predicted Effect probably damaging
Transcript: ENSMUST00000209479
AA Change: T337I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215046
Predicted Effect probably damaging
Transcript: ENSMUST00000216286
AA Change: T344I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.1486 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in rats encodes a protein that modulates glutamate signaling in the brain by regulating kainate receptor function. Expression of this gene may be a biomarker for proliferating infantile hemangiomas. A pseudogene of this gene is located on the long arm of chromosome 8. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null mutation show normal brain morphology and kainate receptor mediated excitatory postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,368,187 probably null Het
Acsm2 A G 7: 119,554,509 H14R unknown Het
Adamtsl4 T C 3: 95,681,759 probably null Het
Ak5 A G 3: 152,655,880 I135T probably damaging Het
Alk G T 17: 71,899,241 S1038* probably null Het
Ank2 A T 3: 126,947,806 probably benign Het
Ap2m1 A T 16: 20,543,384 H414L possibly damaging Het
Atp13a5 A T 16: 29,282,024 M649K probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cdc25b A G 2: 131,191,698 S186G probably benign Het
Ceacam16 A G 7: 19,853,589 V418A possibly damaging Het
Cntnap3 A C 13: 64,778,853 S568A possibly damaging Het
Col24a1 G T 3: 145,314,383 V172F possibly damaging Het
E430018J23Rik T G 7: 127,393,002 Q87P possibly damaging Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Esp36 T A 17: 38,418,956 T15S unknown Het
Fam126a A C 5: 23,979,581 C218G possibly damaging Het
Fam26f T A 10: 34,127,831 T27S probably damaging Het
Fat2 A T 11: 55,309,640 H869Q possibly damaging Het
Fat3 A G 9: 16,031,152 V1308A probably damaging Het
Gimap3 T C 6: 48,765,946 T17A possibly damaging Het
Hnrnpr A G 4: 136,317,148 K13R probably benign Het
Kdr A G 5: 75,943,925 M1133T possibly damaging Het
Mgarp A G 3: 51,396,260 probably benign Het
Nfib C T 4: 82,498,435 R137Q probably damaging Het
Nr3c2 A G 8: 77,217,467 E890G probably damaging Het
Nsun4 A G 4: 116,040,130 V228A possibly damaging Het
Nt5c1a T A 4: 123,215,896 S263T probably benign Het
Ntm A T 9: 29,012,220 Y45* probably null Het
Nts A G 10: 102,485,027 V67A probably benign Het
Olfr1288 T A 2: 111,479,412 C209* probably null Het
Olfr378 A T 11: 73,425,711 S91T possibly damaging Het
Olfr384 A G 11: 73,602,886 Y102C probably damaging Het
Olfr610 T A 7: 103,506,139 K269M probably benign Het
Ostm1 C A 10: 42,679,123 A47E probably benign Het
Otol1 G A 3: 70,018,548 V19M probably benign Het
Pcdhb15 A G 18: 37,475,512 N599S probably damaging Het
Pcdhgb1 T C 18: 37,681,251 I265T probably damaging Het
Pdzd3 T C 9: 44,247,988 *499W probably null Het
Pex14 T C 4: 148,961,510 E321G possibly damaging Het
Phactr3 C A 2: 178,283,132 R251S probably damaging Het
Pkdcc C T 17: 83,221,141 T313M probably benign Het
Plce1 A T 19: 38,767,301 E1911V probably damaging Het
Ptprv G T 1: 135,114,570 noncoding transcript Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rhob A G 12: 8,499,533 Y34H possibly damaging Het
Slc27a3 G A 3: 90,387,340 T408M probably damaging Het
Slc9c1 A T 16: 45,599,466 I1000F possibly damaging Het
Tcf7 G T 11: 52,261,615 P36T probably benign Het
Tcf7l1 C G 6: 72,788,769 E62Q probably damaging Het
Tctex1d4 C T 4: 117,128,123 R48C probably damaging Het
Tll2 A G 19: 41,121,348 S326P probably benign Het
Tubgcp4 A G 2: 121,184,473 N288S probably benign Het
Zfhx3 G A 8: 108,955,637 R3236H unknown Het
Zgrf1 A G 3: 127,562,078 T318A probably benign Het
Other mutations in Neto2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Neto2 APN 8 85641003 missense probably damaging 1.00
IGL01938:Neto2 APN 8 85690855 missense probably benign 0.00
IGL02238:Neto2 APN 8 85669663 missense probably damaging 0.99
IGL02605:Neto2 APN 8 85663435 splice site probably benign
IGL02813:Neto2 APN 8 85690886 missense probably benign
R0138:Neto2 UTSW 8 85641044 missense possibly damaging 0.72
R1934:Neto2 UTSW 8 85670404 missense possibly damaging 0.96
R2402:Neto2 UTSW 8 85690912 missense probably benign 0.00
R2423:Neto2 UTSW 8 85669767 missense probably damaging 1.00
R3821:Neto2 UTSW 8 85663295 nonsense probably null
R3822:Neto2 UTSW 8 85663295 nonsense probably null
R3883:Neto2 UTSW 8 85663265 missense probably damaging 1.00
R3939:Neto2 UTSW 8 85674118 missense probably damaging 0.99
R3940:Neto2 UTSW 8 85674118 missense probably damaging 0.99
R3941:Neto2 UTSW 8 85674118 missense probably damaging 0.99
R4668:Neto2 UTSW 8 85641062 missense probably damaging 1.00
R4675:Neto2 UTSW 8 85669704 missense probably damaging 1.00
R4908:Neto2 UTSW 8 85669764 missense probably damaging 0.99
R5459:Neto2 UTSW 8 85670483 missense probably benign 0.35
R5471:Neto2 UTSW 8 85640760 missense probably benign 0.41
R5544:Neto2 UTSW 8 85647877 missense possibly damaging 0.94
R5571:Neto2 UTSW 8 85640544 missense probably damaging 1.00
R6083:Neto2 UTSW 8 85640585 missense probably benign 0.00
R6339:Neto2 UTSW 8 85640558 missense probably benign 0.33
R6381:Neto2 UTSW 8 85642509 missense probably damaging 0.99
R6572:Neto2 UTSW 8 85670404 missense possibly damaging 0.96
R6593:Neto2 UTSW 8 85669546 missense probably damaging 1.00
R6662:Neto2 UTSW 8 85663215 missense probably damaging 1.00
R6881:Neto2 UTSW 8 85640556 missense probably damaging 1.00
R6950:Neto2 UTSW 8 85670443 missense probably damaging 1.00
R7121:Neto2 UTSW 8 85670391 splice site probably null
R7754:Neto2 UTSW 8 85669700 missense probably damaging 0.98
R7755:Neto2 UTSW 8 85669656 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCCAGATCTGCAGAAATCTC -3'
(R):5'- GTTACTTGACTCAGAAATCATGGG -3'

Sequencing Primer
(F):5'- GCCAGATCTGCAGAAATCTCTTTCTC -3'
(R):5'- AAAACCAGGTTTTTAGGGTCTGG -3'
Posted On2015-07-21