Incidental Mutation 'R6582:Abhd6'
ID524184
Institutional Source Beutler Lab
Gene Symbol Abhd6
Ensembl Gene ENSMUSG00000025277
Gene Nameabhydrolase domain containing 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6582 (G1)
Quality Score212.009
Status Validated
Chromosome14
Chromosomal Location8002902-8056763 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 8042828 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026313] [ENSMUST00000166497] [ENSMUST00000225234]
Predicted Effect probably null
Transcript: ENSMUST00000026313
SMART Domains Protein: ENSMUSP00000026313
Gene: ENSMUSG00000025277

DomainStartEndE-ValueType
Pfam:Hydrolase_4 68 313 6.4e-17 PFAM
Pfam:Abhydrolase_1 72 193 3.8e-17 PFAM
Pfam:Abhydrolase_5 73 307 1e-17 PFAM
Pfam:Abhydrolase_6 74 319 9e-22 PFAM
Pfam:Abhydrolase_1 222 313 1.3e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166497
SMART Domains Protein: ENSMUSP00000129169
Gene: ENSMUSG00000025277

DomainStartEndE-ValueType
Pfam:Lipase 51 183 1.1e-8 PFAM
Pfam:Abhydrolase_5 73 307 8e-18 PFAM
Pfam:Abhydrolase_6 74 319 1.7e-39 PFAM
Pfam:Abhydrolase_1 98 322 3.9e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000225234
Meta Mutation Damage Score 0.9486 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,225 T2369A probably benign Het
Acsm3 A G 7: 119,779,673 E426G probably benign Het
Ankrd11 T C 8: 122,891,629 D1828G probably benign Het
Asmt T A X: 170,675,031 probably null Het
Casp4 A G 9: 5,324,884 Q232R probably benign Het
Cenpt A T 8: 105,849,201 L171* probably null Het
Chd3 AGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGG 11: 69,369,156 probably benign Het
Col5a2 G T 1: 45,390,115 H948N possibly damaging Het
Dnah9 G T 11: 66,061,097 H1859N probably damaging Het
Dscaml1 G A 9: 45,752,806 R1993Q probably benign Het
Fbxw8 C A 5: 118,124,963 R217L probably benign Het
Flnb T G 14: 7,892,275 probably null Het
Fyb2 A G 4: 104,945,542 N214D probably benign Het
Gbp2b A G 3: 142,611,040 E484G possibly damaging Het
Gzmk A G 13: 113,180,511 Y45H probably damaging Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Kcnj6 A G 16: 94,832,826 V142A possibly damaging Het
Klri2 A T 6: 129,739,133 I81K possibly damaging Het
Lama3 T A 18: 12,577,840 V3144E probably damaging Het
Mark1 G A 1: 184,912,589 S390L possibly damaging Het
Mbd3l1 T C 9: 18,484,728 Y50H probably benign Het
Mcat T C 15: 83,549,182 N220S probably benign Het
Muc2 A G 7: 141,696,698 E81G probably benign Het
Neto1 A T 18: 86,494,860 K327* probably null Het
Olfr1200 A T 2: 88,768,243 L24Q probably damaging Het
Olfr218 G T 1: 173,204,280 R308L probably benign Het
Olfr654 T C 7: 104,588,011 L69P probably damaging Het
Olfr656 A T 7: 104,618,441 Y254F probably damaging Het
Pidd1 A T 7: 141,439,581 V722D probably damaging Het
Ppp2r2a G T 14: 67,019,804 H326N probably damaging Het
Smarca5 G A 8: 80,719,652 T473I probably damaging Het
Spg11 C A 2: 122,092,292 W892L probably damaging Het
Tas2r110 T A 6: 132,868,285 I93N possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r71 T A 7: 10,748,681 I27F probably benign Het
Vsnl1 A G 12: 11,326,488 V132A probably benign Het
Wdsub1 T C 2: 59,878,308 T74A probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Abhd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02475:Abhd6 APN 14 8039849 missense probably damaging 0.96
R1757:Abhd6 UTSW 14 8049867 missense probably damaging 1.00
R2011:Abhd6 UTSW 14 8042742 missense probably benign 0.07
R2425:Abhd6 UTSW 14 8049857 missense probably benign 0.29
R3810:Abhd6 UTSW 14 8045603 missense probably benign 0.01
R4809:Abhd6 UTSW 14 8039771 start codon destroyed probably null 1.00
R5841:Abhd6 UTSW 14 8049596 missense probably benign 0.02
R5878:Abhd6 UTSW 14 8028286 missense probably benign 0.13
R6439:Abhd6 UTSW 14 8055589 missense probably damaging 1.00
R6582:Abhd6 UTSW 14 8042826 missense probably damaging 1.00
R6924:Abhd6 UTSW 14 8049850 missense possibly damaging 0.71
R7684:Abhd6 UTSW 14 8039807 missense probably damaging 1.00
R7844:Abhd6 UTSW 14 8039792 missense probably benign 0.22
R8093:Abhd6 UTSW 14 8028353 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAATAGCCAGCGTCAGACCCAG -3'
(R):5'- GTCAATTTGGCTATGGTTCTCAC -3'

Sequencing Primer
(F):5'- AGGGTCCAACCGCATTGAG -3'
(R):5'- GGCTATGGTTCTCACAATATAACTG -3'
Posted On2018-06-22