Incidental Mutation 'R6582:Ivl'
Institutional Source Beutler Lab
Gene Symbol Ivl
Ensembl Gene ENSMUSG00000049128
Gene Nameinvolucrin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6582 (G1)
Quality Score217.468
Status Validated
Chromosomal Location92570902-92573735 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) CCTGCTGCTGCTGCT to CCTGCTGCTGCT at 92571910 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000059780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053107]
Predicted Effect probably benign
Transcript: ENSMUST00000053107
SMART Domains Protein: ENSMUSP00000059780
Gene: ENSMUSG00000049128

Pfam:Involucrin_N 1 67 2e-32 PFAM
Pfam:Involucrin2 94 134 1.3e-7 PFAM
Pfam:Involucrin2 173 211 1.9e-13 PFAM
Pfam:Involucrin2 210 249 4.1e-12 PFAM
Pfam:Involucrin2 239 278 2.9e-13 PFAM
Pfam:Involucrin2 268 306 4.1e-10 PFAM
Pfam:Involucrin2 311 351 4.6e-14 PFAM
Pfam:Involucrin2 343 376 1.3e-10 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,225 T2369A probably benign Het
Abhd6 G T 14: 8,042,826 G128C probably damaging Het
Abhd6 T G 14: 8,042,828 probably null Het
Acsm3 A G 7: 119,779,673 E426G probably benign Het
Ankrd11 T C 8: 122,891,629 D1828G probably benign Het
Asmt T A X: 170,675,031 probably null Het
Casp4 A G 9: 5,324,884 Q232R probably benign Het
Cenpt A T 8: 105,849,201 L171* probably null Het
Chd3 AGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGG 11: 69,369,156 probably benign Het
Col5a2 G T 1: 45,390,115 H948N possibly damaging Het
Dnah9 G T 11: 66,061,097 H1859N probably damaging Het
Dscaml1 G A 9: 45,752,806 R1993Q probably benign Het
Fbxw8 C A 5: 118,124,963 R217L probably benign Het
Flnb T G 14: 7,892,275 probably null Het
Fyb2 A G 4: 104,945,542 N214D probably benign Het
Gbp2b A G 3: 142,611,040 E484G possibly damaging Het
Gzmk A G 13: 113,180,511 Y45H probably damaging Het
Kcnj6 A G 16: 94,832,826 V142A possibly damaging Het
Klri2 A T 6: 129,739,133 I81K possibly damaging Het
Lama3 T A 18: 12,577,840 V3144E probably damaging Het
Mark1 G A 1: 184,912,589 S390L possibly damaging Het
Mbd3l1 T C 9: 18,484,728 Y50H probably benign Het
Mcat T C 15: 83,549,182 N220S probably benign Het
Muc2 A G 7: 141,696,698 E81G probably benign Het
Neto1 A T 18: 86,494,860 K327* probably null Het
Olfr1200 A T 2: 88,768,243 L24Q probably damaging Het
Olfr218 G T 1: 173,204,280 R308L probably benign Het
Olfr654 T C 7: 104,588,011 L69P probably damaging Het
Olfr656 A T 7: 104,618,441 Y254F probably damaging Het
Pidd1 A T 7: 141,439,581 V722D probably damaging Het
Ppp2r2a G T 14: 67,019,804 H326N probably damaging Het
Smarca5 G A 8: 80,719,652 T473I probably damaging Het
Spg11 C A 2: 122,092,292 W892L probably damaging Het
Tas2r110 T A 6: 132,868,285 I93N possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r71 T A 7: 10,748,681 I27F probably benign Het
Vsnl1 A G 12: 11,326,488 V132A probably benign Het
Wdsub1 T C 2: 59,878,308 T74A probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Ivl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Ivl APN 3 92572512 missense possibly damaging 0.68
IGL01656:Ivl APN 3 92571655 nonsense probably null
IGL01820:Ivl APN 3 92571633 missense possibly damaging 0.95
IGL03012:Ivl APN 3 92572426 missense probably benign 0.01
PIT4142001:Ivl UTSW 3 92572301 small deletion probably benign
PIT4151001:Ivl UTSW 3 92572301 small deletion probably benign
PIT4458001:Ivl UTSW 3 92572301 small insertion probably benign
R0256:Ivl UTSW 3 92571843 missense probably damaging 1.00
R0276:Ivl UTSW 3 92571514 missense unknown
R1800:Ivl UTSW 3 92572584 missense unknown
R1940:Ivl UTSW 3 92572749 missense probably benign 0.00
R1950:Ivl UTSW 3 92572113 missense possibly damaging 0.85
R2887:Ivl UTSW 3 92571392 missense unknown
R4457:Ivl UTSW 3 92572366 missense probably benign 0.03
R4561:Ivl UTSW 3 92571955 small insertion probably benign
R4562:Ivl UTSW 3 92571955 small insertion probably benign
R4698:Ivl UTSW 3 92571391 missense unknown
R4708:Ivl UTSW 3 92571750 missense probably damaging 1.00
R4885:Ivl UTSW 3 92572411 missense probably benign 0.03
R6354:Ivl UTSW 3 92571910 small deletion probably benign
R6355:Ivl UTSW 3 92571910 small deletion probably benign
R6356:Ivl UTSW 3 92571910 small deletion probably benign
R6723:Ivl UTSW 3 92571387 missense unknown
R7091:Ivl UTSW 3 92572242 missense possibly damaging 0.85
R7146:Ivl UTSW 3 92572231 missense probably damaging 0.97
R7755:Ivl UTSW 3 92572010 missense probably damaging 0.98
R7841:Ivl UTSW 3 92572392 missense possibly damaging 0.52
R8048:Ivl UTSW 3 92571924 missense probably damaging 1.00
R8171:Ivl UTSW 3 92571778 missense probably damaging 1.00
R8363:Ivl UTSW 3 92572218 missense possibly damaging 0.71
R8434:Ivl UTSW 3 92572636 missense probably benign 0.01
R8504:Ivl UTSW 3 92572771 start gained probably benign
RF013:Ivl UTSW 3 92572343 small deletion probably benign
RF031:Ivl UTSW 3 92572318 frame shift probably null
RF036:Ivl UTSW 3 92572341 frame shift probably null
RF038:Ivl UTSW 3 92572300 small deletion probably benign
RF055:Ivl UTSW 3 92572300 small deletion probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2018-06-22