Incidental Mutation 'R6582:Tas2r110'
Institutional Source Beutler Lab
Gene Symbol Tas2r110
Ensembl Gene ENSMUSG00000062952
Gene Nametaste receptor, type 2, member 110
SynonymsSTC 9-1, Tas2r10, T2R10, mt2r57
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6582 (G1)
Quality Score225.009
Status Validated
Chromosomal Location132868008-132869009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 132868285 bp
Amino Acid Change Isoleucine to Asparagine at position 93 (I93N)
Ref Sequence ENSEMBL: ENSMUSP00000080674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082014]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082014
AA Change: I93N

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080674
Gene: ENSMUSG00000062952
AA Change: I93N

Pfam:TAS2R 6 322 3.1e-82 PFAM
Meta Mutation Damage Score 0.3181 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,225 T2369A probably benign Het
Abhd6 G T 14: 8,042,826 G128C probably damaging Het
Abhd6 T G 14: 8,042,828 probably null Het
Acsm3 A G 7: 119,779,673 E426G probably benign Het
Ankrd11 T C 8: 122,891,629 D1828G probably benign Het
Asmt T A X: 170,675,031 probably null Het
Casp4 A G 9: 5,324,884 Q232R probably benign Het
Cenpt A T 8: 105,849,201 L171* probably null Het
Chd3 AGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGG 11: 69,369,156 probably benign Het
Col5a2 G T 1: 45,390,115 H948N possibly damaging Het
Dnah9 G T 11: 66,061,097 H1859N probably damaging Het
Dscaml1 G A 9: 45,752,806 R1993Q probably benign Het
Fbxw8 C A 5: 118,124,963 R217L probably benign Het
Flnb T G 14: 7,892,275 probably null Het
Fyb2 A G 4: 104,945,542 N214D probably benign Het
Gbp2b A G 3: 142,611,040 E484G possibly damaging Het
Gzmk A G 13: 113,180,511 Y45H probably damaging Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Kcnj6 A G 16: 94,832,826 V142A possibly damaging Het
Klri2 A T 6: 129,739,133 I81K possibly damaging Het
Lama3 T A 18: 12,577,840 V3144E probably damaging Het
Mark1 G A 1: 184,912,589 S390L possibly damaging Het
Mbd3l1 T C 9: 18,484,728 Y50H probably benign Het
Mcat T C 15: 83,549,182 N220S probably benign Het
Muc2 A G 7: 141,696,698 E81G probably benign Het
Neto1 A T 18: 86,494,860 K327* probably null Het
Olfr1200 A T 2: 88,768,243 L24Q probably damaging Het
Olfr218 G T 1: 173,204,280 R308L probably benign Het
Olfr654 T C 7: 104,588,011 L69P probably damaging Het
Olfr656 A T 7: 104,618,441 Y254F probably damaging Het
Pidd1 A T 7: 141,439,581 V722D probably damaging Het
Ppp2r2a G T 14: 67,019,804 H326N probably damaging Het
Smarca5 G A 8: 80,719,652 T473I probably damaging Het
Spg11 C A 2: 122,092,292 W892L probably damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r71 T A 7: 10,748,681 I27F probably benign Het
Vsnl1 A G 12: 11,326,488 V132A probably benign Het
Wdsub1 T C 2: 59,878,308 T74A probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Tas2r110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03103:Tas2r110 APN 6 132868480 missense probably benign 0.09
IGL03275:Tas2r110 APN 6 132868098 missense probably damaging 0.99
R0111:Tas2r110 UTSW 6 132868203 missense probably benign 0.00
R0539:Tas2r110 UTSW 6 132868371 missense possibly damaging 0.63
R1432:Tas2r110 UTSW 6 132868368 missense probably damaging 1.00
R1672:Tas2r110 UTSW 6 132868066 missense probably damaging 1.00
R2483:Tas2r110 UTSW 6 132868470 missense probably benign 0.00
R3110:Tas2r110 UTSW 6 132868024 missense unknown
R3112:Tas2r110 UTSW 6 132868024 missense unknown
R3623:Tas2r110 UTSW 6 132868470 missense probably benign 0.00
R3847:Tas2r110 UTSW 6 132868675 missense probably damaging 1.00
R3849:Tas2r110 UTSW 6 132868675 missense probably damaging 1.00
R3850:Tas2r110 UTSW 6 132868675 missense probably damaging 1.00
R4871:Tas2r110 UTSW 6 132868128 missense probably benign 0.09
R5010:Tas2r110 UTSW 6 132868475 nonsense probably null
R5108:Tas2r110 UTSW 6 132868705 missense probably damaging 1.00
R5289:Tas2r110 UTSW 6 132868009 start codon destroyed probably null
R5938:Tas2r110 UTSW 6 132868053 missense probably benign 0.39
R6262:Tas2r110 UTSW 6 132868675 missense probably damaging 0.96
R6286:Tas2r110 UTSW 6 132868527 missense probably benign 0.01
R7236:Tas2r110 UTSW 6 132868704 missense possibly damaging 0.76
X0024:Tas2r110 UTSW 6 132868633 missense probably damaging 1.00
Z1176:Tas2r110 UTSW 6 132868611 missense probably benign 0.37
Predicted Primers PCR Primer

Sequencing Primer
Posted On2018-06-22