Incidental Mutation 'R6582:Casp4'
ID524166
Institutional Source Beutler Lab
Gene Symbol Casp4
Ensembl Gene ENSMUSG00000033538
Gene Namecaspase 4, apoptosis-related cysteine peptidase
SynonymsCasp11, Caspase-11, ich-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6582 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location5308828-5336783 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5324884 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 232 (Q232R)
Ref Sequence ENSEMBL: ENSMUSP00000027012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027012] [ENSMUST00000160064] [ENSMUST00000162846]
Predicted Effect probably benign
Transcript: ENSMUST00000027012
AA Change: Q232R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000027012
Gene: ENSMUSG00000033538
AA Change: Q232R

DomainStartEndE-ValueType
CARD 1 92 7.63e-7 SMART
CASc 121 371 5.72e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152651
Predicted Effect probably benign
Transcript: ENSMUST00000159461
SMART Domains Protein: ENSMUSP00000124535
Gene: ENSMUSG00000033538

DomainStartEndE-ValueType
SCOP:d1dgna_ 2 32 7e-7 SMART
Blast:CARD 2 40 9e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160064
SMART Domains Protein: ENSMUSP00000124249
Gene: ENSMUSG00000033538

DomainStartEndE-ValueType
CARD 1 89 4.7e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160521
Predicted Effect probably benign
Transcript: ENSMUST00000162846
SMART Domains Protein: ENSMUSP00000124402
Gene: ENSMUSG00000033538

DomainStartEndE-ValueType
Blast:CARD 2 36 2e-17 BLAST
PDB:1IBC|A 18 94 6e-12 PDB
SCOP:g1ibc.1 45 94 6e-15 SMART
Blast:CASc 65 94 7e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163086
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a member of the cysteine proteases that plays important roles in apoptosis, cell migration and the inflammatory response. The encoded protein mediates production of pro-inflammatory cytokines by macrophages upon bacterial infection. Mice lacking the encoded protein are resistant to endotoxic shock induced by lipopolysaccharide. A 5-bp deletion encompassing a splice acceptor junction resulting in alternate splicing and a shorter non-functional isoform in certain mouse strains has been described. Although its official nomenclature is "caspase 4, apoptosis-related cysteine peptidase", this gene and its encoded protein have historically been called caspase 11. This gene is present in a cluster of three caspase genes on chromosome 9. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in decreased levels of serum IL-1alpha and IL-1beta. Mutant animals are resistant to septic shock after injection with LPS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,225 T2369A probably benign Het
Abhd6 G T 14: 8,042,826 G128C probably damaging Het
Abhd6 T G 14: 8,042,828 probably null Het
Acsm3 A G 7: 119,779,673 E426G probably benign Het
Ankrd11 T C 8: 122,891,629 D1828G probably benign Het
Asmt T A X: 170,675,031 probably null Het
Cenpt A T 8: 105,849,201 L171* probably null Het
Chd3 AGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGG 11: 69,369,156 probably benign Het
Col5a2 G T 1: 45,390,115 H948N possibly damaging Het
Dnah9 G T 11: 66,061,097 H1859N probably damaging Het
Dscaml1 G A 9: 45,752,806 R1993Q probably benign Het
Fbxw8 C A 5: 118,124,963 R217L probably benign Het
Flnb T G 14: 7,892,275 probably null Het
Fyb2 A G 4: 104,945,542 N214D probably benign Het
Gbp2b A G 3: 142,611,040 E484G possibly damaging Het
Gzmk A G 13: 113,180,511 Y45H probably damaging Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Kcnj6 A G 16: 94,832,826 V142A possibly damaging Het
Klri2 A T 6: 129,739,133 I81K possibly damaging Het
Lama3 T A 18: 12,577,840 V3144E probably damaging Het
Mark1 G A 1: 184,912,589 S390L possibly damaging Het
Mbd3l1 T C 9: 18,484,728 Y50H probably benign Het
Mcat T C 15: 83,549,182 N220S probably benign Het
Muc2 A G 7: 141,696,698 E81G probably benign Het
Neto1 A T 18: 86,494,860 K327* probably null Het
Olfr1200 A T 2: 88,768,243 L24Q probably damaging Het
Olfr218 G T 1: 173,204,280 R308L probably benign Het
Olfr654 T C 7: 104,588,011 L69P probably damaging Het
Olfr656 A T 7: 104,618,441 Y254F probably damaging Het
Pidd1 A T 7: 141,439,581 V722D probably damaging Het
Ppp2r2a G T 14: 67,019,804 H326N probably damaging Het
Smarca5 G A 8: 80,719,652 T473I probably damaging Het
Spg11 C A 2: 122,092,292 W892L probably damaging Het
Tas2r110 T A 6: 132,868,285 I93N possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r71 T A 7: 10,748,681 I27F probably benign Het
Vsnl1 A G 12: 11,326,488 V132A probably benign Het
Wdsub1 T C 2: 59,878,308 T74A probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Casp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02688:Casp4 APN 9 5322844 missense possibly damaging 0.76
BB007:Casp4 UTSW 9 5321318 missense probably damaging 0.99
BB017:Casp4 UTSW 9 5321318 missense probably damaging 0.99
R1302:Casp4 UTSW 9 5328518 nonsense probably null
R1562:Casp4 UTSW 9 5324733 missense possibly damaging 0.69
R1716:Casp4 UTSW 9 5308919 splice site probably null
R2031:Casp4 UTSW 9 5321401 missense probably benign 0.00
R2655:Casp4 UTSW 9 5322894 missense possibly damaging 0.93
R4207:Casp4 UTSW 9 5328451 missense probably benign 0.15
R4432:Casp4 UTSW 9 5323653 missense probably damaging 1.00
R4911:Casp4 UTSW 9 5328580 unclassified probably benign
R5269:Casp4 UTSW 9 5321521 splice site probably benign
R5399:Casp4 UTSW 9 5324928 nonsense probably null
R5800:Casp4 UTSW 9 5308915 critical splice donor site probably null
R5895:Casp4 UTSW 9 5328573 unclassified probably benign
R7253:Casp4 UTSW 9 5324868 missense probably benign 0.37
R7426:Casp4 UTSW 9 5321345 missense possibly damaging 0.87
R7930:Casp4 UTSW 9 5321318 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCATCCCACTAACGAAGTC -3'
(R):5'- ACTTGGGGATTCTGGAAAAGTTC -3'

Sequencing Primer
(F):5'- AAGTCATCGATTTTTCCAGGGC -3'
(R):5'- CCAGGCAAATTTTTGTAATGGCAC -3'
Posted On2018-06-22