Incidental Mutation 'R6654:Gsta4'
ID526561
Institutional Source Beutler Lab
Gene Symbol Gsta4
Ensembl Gene ENSMUSG00000032348
Gene Nameglutathione S-transferase, alpha 4
SynonymsmGsta4, GST 5.7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6654 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location78182774-78209349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78209099 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 197 (F197L)
Ref Sequence ENSEMBL: ENSMUSP00000034903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034903] [ENSMUST00000213215]
PDB Structure
CRYSTAL STRUCTURE OF MGSTA4-4 IN COMPLEX WITH GSH CONJUGATE OF 4-HYDROXYNONENAL IN ONE SUBUNIT AND GSH IN THE OTHER: EVIDENCE OF SIGNALING ACROSS DIMER INTERFACE IN MGSTA4-4 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MURINE ALPHA-CLASS GSTA4-4 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000034903
AA Change: F197L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034903
Gene: ENSMUSG00000032348
AA Change: F197L

DomainStartEndE-ValueType
Pfam:GST_N 5 77 1.2e-19 PFAM
Pfam:GST_C 99 192 5.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216513
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 97% (35/36)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display increased sensitivity to oxidative stress, increased alanine and aspartate transaminase levels, increased susceptibility to bacterial infection, reduced litter size, and impaired glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,171,884 M154L unknown Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Armc6 T C 8: 70,231,375 E9G probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ddc A T 11: 11,880,452 I64N probably damaging Het
Exd1 T A 2: 119,524,717 probably null Het
Gm13757 T G 2: 88,446,672 T89P possibly damaging Het
Gm15922 A T 7: 3,735,929 S560T probably benign Het
Gm4847 C A 1: 166,630,387 G466C probably damaging Het
Gm5431 T C 11: 48,894,600 D316G possibly damaging Het
Irs2 A G 8: 11,006,486 Y649H probably damaging Het
Kif16b T C 2: 142,701,277 probably benign Het
Krtap12-1 T C 10: 77,720,703 probably benign Het
Ktn1 G A 14: 47,690,000 S537N probably damaging Het
Med12l G T 3: 59,262,292 G1626W probably damaging Het
Mfng T A 15: 78,759,339 T223S probably damaging Het
Msh3 T C 13: 92,345,042 T321A probably benign Het
Myo7b T C 18: 31,990,269 I672V possibly damaging Het
Nbas C T 12: 13,483,874 Q1837* probably null Het
Nlrc4 G A 17: 74,445,528 A620V possibly damaging Het
Nubpl T A 12: 52,310,733 V310E probably damaging Het
Olfr1109 A G 2: 87,093,050 S116P probably benign Het
P2ry12 A G 3: 59,218,020 L78P probably damaging Het
Pkd1l3 T G 8: 109,624,283 S587A probably benign Het
Prkacb A G 3: 146,750,543 V145A possibly damaging Het
Rpgrip1l T C 8: 91,220,205 E1256G probably benign Het
Rsph4a A G 10: 33,912,992 Q611R probably benign Het
Sorl1 T C 9: 41,980,645 D1903G possibly damaging Het
Tmem39b A T 4: 129,686,826 V291D probably damaging Het
Unc79 A C 12: 103,079,048 K685Q probably damaging Het
Unc79 A T 12: 103,079,049 K685I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r112 G T 17: 22,603,469 S376I possibly damaging Het
Zfp850 A T 7: 27,985,215 C35* probably null Het
Zfp974 A G 7: 27,926,403 V14A probably damaging Het
Other mutations in Gsta4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Gsta4 APN 9 78205922 missense possibly damaging 0.63
IGL02442:Gsta4 APN 9 78209165 missense probably benign
IGL03088:Gsta4 APN 9 78206063 unclassified probably benign
R1668:Gsta4 UTSW 9 78204288 missense probably benign 0.00
R1766:Gsta4 UTSW 9 78204329 nonsense probably null
R4578:Gsta4 UTSW 9 78206020 missense probably benign 0.12
R8190:Gsta4 UTSW 9 78198372 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CTAGGCGTTGTCTGTTAAGAAC -3'
(R):5'- CTATATACCTTGCTTCTGGAATGC -3'

Sequencing Primer
(F):5'- GCCATCTGTCTGCATGTAAATG -3'
(R):5'- TCTGGAATGCTCTGCAGC -3'
Posted On2018-07-23