Incidental Mutation 'R6654:Prkacb'
ID526550
Institutional Source Beutler Lab
Gene Symbol Prkacb
Ensembl Gene ENSMUSG00000005034
Gene Nameprotein kinase, cAMP dependent, catalytic, beta
SynonymscAMP-dependent protein kinase C beta, Pkacb
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.645) question?
Stock #R6654 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location146729574-146812990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146750543 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 145 (V145A)
Ref Sequence ENSEMBL: ENSMUSP00000142490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005164] [ENSMUST00000102515] [ENSMUST00000106137] [ENSMUST00000106138] [ENSMUST00000197616] [ENSMUST00000199722]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005164
AA Change: V167A

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000005164
Gene: ENSMUSG00000005034
AA Change: V167A

DomainStartEndE-ValueType
S_TKc 91 345 1.07e-105 SMART
S_TK_X 346 398 2.47e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102515
AA Change: V120A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099573
Gene: ENSMUSG00000005034
AA Change: V120A

DomainStartEndE-ValueType
S_TKc 44 298 5.3e-108 SMART
S_TK_X 299 344 2.1e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106137
AA Change: V107A

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101743
Gene: ENSMUSG00000005034
AA Change: V107A

DomainStartEndE-ValueType
S_TKc 31 285 1.07e-105 SMART
S_TK_X 286 338 2.47e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106138
AA Change: V108A

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101744
Gene: ENSMUSG00000005034
AA Change: V108A

DomainStartEndE-ValueType
S_TKc 32 286 1.07e-105 SMART
S_TK_X 287 339 2.47e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144369
Predicted Effect possibly damaging
Transcript: ENSMUST00000197616
AA Change: V145A

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142490
Gene: ENSMUSG00000005034
AA Change: V145A

DomainStartEndE-ValueType
Pfam:Pkinase 69 189 4.6e-27 PFAM
Pfam:Pkinase_Tyr 69 189 1.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199722
AA Change: V62A

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000143303
Gene: ENSMUSG00000005034
AA Change: V62A

DomainStartEndE-ValueType
STYKc 1 106 1.5e-6 SMART
Meta Mutation Damage Score 0.4013 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. The encoded protein is a catalytic subunit of cAMP (cyclic AMP)-dependent protein kinase, which mediates signalling though cAMP. cAMP signaling is important to a number of processes, including cell proliferaton and differentiation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygotes for a targeted null mutation eliminating the Cbeta1 subunit exhibit impaired hippocampal plasticity, including failure of low frequency stimulation to produce lasting depression and the elimination of mossy fiber long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,171,884 M154L unknown Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Armc6 T C 8: 70,231,375 E9G probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ddc A T 11: 11,880,452 I64N probably damaging Het
Exd1 T A 2: 119,524,717 probably null Het
Gm13757 T G 2: 88,446,672 T89P possibly damaging Het
Gm15922 A T 7: 3,735,929 S560T probably benign Het
Gm4847 C A 1: 166,630,387 G466C probably damaging Het
Gm5431 T C 11: 48,894,600 D316G possibly damaging Het
Gsta4 T C 9: 78,209,099 F197L probably damaging Het
Irs2 A G 8: 11,006,486 Y649H probably damaging Het
Kif16b T C 2: 142,701,277 probably benign Het
Krtap12-1 T C 10: 77,720,703 probably benign Het
Ktn1 G A 14: 47,690,000 S537N probably damaging Het
Med12l G T 3: 59,262,292 G1626W probably damaging Het
Mfng T A 15: 78,759,339 T223S probably damaging Het
Msh3 T C 13: 92,345,042 T321A probably benign Het
Myo7b T C 18: 31,990,269 I672V possibly damaging Het
Nbas C T 12: 13,483,874 Q1837* probably null Het
Nlrc4 G A 17: 74,445,528 A620V possibly damaging Het
Nubpl T A 12: 52,310,733 V310E probably damaging Het
Olfr1109 A G 2: 87,093,050 S116P probably benign Het
P2ry12 A G 3: 59,218,020 L78P probably damaging Het
Pkd1l3 T G 8: 109,624,283 S587A probably benign Het
Rpgrip1l T C 8: 91,220,205 E1256G probably benign Het
Rsph4a A G 10: 33,912,992 Q611R probably benign Het
Sorl1 T C 9: 41,980,645 D1903G possibly damaging Het
Tmem39b A T 4: 129,686,826 V291D probably damaging Het
Unc79 A C 12: 103,079,048 K685Q probably damaging Het
Unc79 A T 12: 103,079,049 K685I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r112 G T 17: 22,603,469 S376I possibly damaging Het
Zfp850 A T 7: 27,985,215 C35* probably null Het
Zfp974 A G 7: 27,926,403 V14A probably damaging Het
Other mutations in Prkacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Prkacb APN 3 146748042 missense probably benign 0.01
IGL01330:Prkacb APN 3 146751511 missense probably damaging 1.00
IGL01419:Prkacb APN 3 146755693 start codon destroyed probably null 0.49
IGL02533:Prkacb APN 3 146732696 missense possibly damaging 0.64
foxhound UTSW 3 146745378 missense probably damaging 1.00
PIT4445001:Prkacb UTSW 3 146755691 missense probably benign 0.13
R0666:Prkacb UTSW 3 146751518 missense probably damaging 0.99
R2169:Prkacb UTSW 3 146746683 splice site probably null
R4559:Prkacb UTSW 3 146745392 unclassified probably benign
R4613:Prkacb UTSW 3 146737998 missense probably damaging 1.00
R4931:Prkacb UTSW 3 146747977 missense possibly damaging 0.91
R6474:Prkacb UTSW 3 146755724 missense probably damaging 1.00
R6505:Prkacb UTSW 3 146732646 missense probably damaging 1.00
R6864:Prkacb UTSW 3 146745378 missense probably damaging 1.00
R6940:Prkacb UTSW 3 146751499 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGCTGTGCTCACCTAGTAC -3'
(R):5'- AAAAGTCTCAGGTTTCTTTGTGGC -3'

Sequencing Primer
(F):5'- GTGCTCACCTAGTACTTCCTATGG -3'
(R):5'- TGGCTGGAATACTAAGGGGGTC -3'
Posted On2018-07-23