Mutagenetix > Incidental Mutations

Incidental Mutation 'R6654:Nlrc4'

526575

Institutional Source

Beutler Lab

Gene Symbol

Nlrc4

Ensembl Gene

ENSMUSG00000039193

Gene Name

NLR family, CARD domain containing 4

Synonyms

Card12, Ipaf, 9530011P19Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.166) question?

Stock #

R6654 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74426295-74459108 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 74445528 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 620 (A620V)

Ref Sequence

ENSEMBL: ENSMUSP00000059637 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052124]

PDB Structure

Crystal structure of NLRC4 reveals its autoinhibition mechanism [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000052124
AA Change: A620V

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000059637
Gene: ENSMUSG00000039193
AA Change: A620V

Domain	Start	End	E-Value	Type
Pfam:CARD	1	87	1.4e-20	PFAM
Pfam:NACHT	163	314	1.3e-28	PFAM
SCOP:d1yrga_	734	1015	3e-20	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

97% (35/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the caspase recruitment domain-containing NLR family. Family members play essential roles in innate immune response to a wide range of pathogenic organisms, tissue damage and other cellular stresses. Mutations in this gene result in autoinflammation with infantile enterocolitis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a null allele show lack of caspase-1 activation in macrophages infected with Legionella and Salmonella, and enhanced permissivity to Legionella replication. Homozygotes for another null allele fail to show caspase dependent cell death andIL-1beta secretion upon Salmonella infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	T	A	2: 111,171,884	M154L	unknown	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Armc6	T	C	8: 70,231,375	E9G	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857		probably null	Het
Ddc	A	T	11: 11,880,452	I64N	probably damaging	Het
Exd1	T	A	2: 119,524,717		probably null	Het
Gm13757	T	G	2: 88,446,672	T89P	possibly damaging	Het
Gm15922	A	T	7: 3,735,929	S560T	probably benign	Het
Gm4847	C	A	1: 166,630,387	G466C	probably damaging	Het
Gm5431	T	C	11: 48,894,600	D316G	possibly damaging	Het
Gsta4	T	C	9: 78,209,099	F197L	probably damaging	Het
Irs2	A	G	8: 11,006,486	Y649H	probably damaging	Het
Kif16b	T	C	2: 142,701,277		probably benign	Het
Krtap12-1	T	C	10: 77,720,703		probably benign	Het
Ktn1	G	A	14: 47,690,000	S537N	probably damaging	Het
Med12l	G	T	3: 59,262,292	G1626W	probably damaging	Het
Mfng	T	A	15: 78,759,339	T223S	probably damaging	Het
Msh3	T	C	13: 92,345,042	T321A	probably benign	Het
Myo7b	T	C	18: 31,990,269	I672V	possibly damaging	Het
Nbas	C	T	12: 13,483,874	Q1837*	probably null	Het
Nubpl	T	A	12: 52,310,733	V310E	probably damaging	Het
Olfr1109	A	G	2: 87,093,050	S116P	probably benign	Het
P2ry12	A	G	3: 59,218,020	L78P	probably damaging	Het
Pkd1l3	T	G	8: 109,624,283	S587A	probably benign	Het
Prkacb	A	G	3: 146,750,543	V145A	possibly damaging	Het
Rpgrip1l	T	C	8: 91,220,205	E1256G	probably benign	Het
Rsph4a	A	G	10: 33,912,992	Q611R	probably benign	Het
Sorl1	T	C	9: 41,980,645	D1903G	possibly damaging	Het
Tmem39b	A	T	4: 129,686,826	V291D	probably damaging	Het
Unc79	A	C	12: 103,079,048	K685Q	probably damaging	Het
Unc79	A	T	12: 103,079,049	K685I	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r112	G	T	17: 22,603,469	S376I	possibly damaging	Het
Zfp850	A	T	7: 27,985,215	C35*	probably null	Het
Zfp974	A	G	7: 27,926,403	V14A	probably damaging	Het

Other mutations in Nlrc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Nlrc4	APN	17	74446534	missense	probably benign	0.02
IGL00427:Nlrc4	APN	17	74447092	missense	probably benign
IGL00823:Nlrc4	APN	17	74447990	missense	probably benign	0.01
IGL01404:Nlrc4	APN	17	74445711	missense	probably damaging	1.00
IGL02178:Nlrc4	APN	17	74446843	missense	probably damaging	1.00
IGL02266:Nlrc4	APN	17	74446167	missense	possibly damaging	0.72
IGL03342:Nlrc4	APN	17	74445318	missense	probably damaging	1.00
Inwood	UTSW	17	74445630	missense	probably damaging	1.00
PIT4305001:Nlrc4	UTSW	17	74446309	missense	probably damaging	0.99
PIT4466001:Nlrc4	UTSW	17	74427119	missense	probably benign	0.01
R0077:Nlrc4	UTSW	17	74446831	missense	probably damaging	1.00
R0398:Nlrc4	UTSW	17	74445920	missense	probably damaging	0.99
R0639:Nlrc4	UTSW	17	74426963	missense	probably benign	0.16
R1498:Nlrc4	UTSW	17	74446413	missense	probably benign	0.43
R1565:Nlrc4	UTSW	17	74441931	missense	probably benign	0.00
R1624:Nlrc4	UTSW	17	74445189	missense	possibly damaging	0.55
R1666:Nlrc4	UTSW	17	74445906	missense	probably damaging	0.97
R1668:Nlrc4	UTSW	17	74445906	missense	probably damaging	0.97
R1690:Nlrc4	UTSW	17	74437523	nonsense	probably null
R1723:Nlrc4	UTSW	17	74441908	missense	probably damaging	1.00
R1988:Nlrc4	UTSW	17	74426943	missense	probably benign	0.09
R1992:Nlrc4	UTSW	17	74445633	missense	probably benign	0.04
R2141:Nlrc4	UTSW	17	74447951	splice site	probably benign
R2256:Nlrc4	UTSW	17	74445630	missense	probably damaging	1.00
R2897:Nlrc4	UTSW	17	74448045	missense	probably benign
R3117:Nlrc4	UTSW	17	74436068	missense	probably benign	0.00
R3861:Nlrc4	UTSW	17	74445621	missense	probably benign	0.00
R4093:Nlrc4	UTSW	17	74445958	missense	probably benign	0.20
R4212:Nlrc4	UTSW	17	74447115	missense	possibly damaging	0.66
R4627:Nlrc4	UTSW	17	74446628	missense	probably damaging	1.00
R4859:Nlrc4	UTSW	17	74436037	missense	probably damaging	0.97
R4968:Nlrc4	UTSW	17	74446941	missense	probably benign	0.20
R5133:Nlrc4	UTSW	17	74446717	missense	possibly damaging	0.91
R5379:Nlrc4	UTSW	17	74448083	nonsense	probably null
R6045:Nlrc4	UTSW	17	74446959	missense	probably damaging	0.98
R6712:Nlrc4	UTSW	17	74446836	missense	probably damaging	0.96
R6976:Nlrc4	UTSW	17	74445939	missense	probably damaging	1.00
R7030:Nlrc4	UTSW	17	74446006	missense	probably damaging	1.00
R7153:Nlrc4	UTSW	17	74447103	missense	possibly damaging	0.84
R7190:Nlrc4	UTSW	17	74445203	missense	probably damaging	1.00
R7398:Nlrc4	UTSW	17	74446542	missense	probably damaging	1.00
R7417:Nlrc4	UTSW	17	74446488	missense	probably benign	0.18
R7468:Nlrc4	UTSW	17	74445512	missense	probably benign	0.00
R7639:Nlrc4	UTSW	17	74447957	critical splice donor site	probably null
R7716:Nlrc4	UTSW	17	74446656	missense	probably damaging	1.00
R7757:Nlrc4	UTSW	17	74448196	missense	probably benign	0.00
R7868:Nlrc4	UTSW	17	74448052	missense	possibly damaging	0.75
R7890:Nlrc4	UTSW	17	74437508	missense	probably benign	0.00
R7920:Nlrc4	UTSW	17	74427119	missense	probably benign	0.01
R7950:Nlrc4	UTSW	17	74445615	missense	probably damaging	1.00
R8154:Nlrc4	UTSW	17	74445909	missense	probably damaging	1.00
R8168:Nlrc4	UTSW	17	74445211	missense	probably benign	0.01
R8311:Nlrc4	UTSW	17	74446545	missense	probably damaging	1.00
X0026:Nlrc4	UTSW	17	74446643	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCAGAGCTGAATATCTTCCC -3'
(R):5'- CGTAGAGTGTGGCATCAATTTGTTC -3'

Sequencing Primer
(F):5'- TCCTGCTTCCAGTTGAAG -3'
(R):5'- GGCATCAATTTGTTCTCAGAGAG -3'

Posted On

2018-07-23