Incidental Mutation 'R6667:3100002H09Rik'
ID 527014
Institutional Source Beutler Lab
Gene Symbol 3100002H09Rik
Ensembl Gene ENSMUSG00000051219
Gene Name RIKEN cDNA 3100002H09 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock # R6667 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 124609931-124610803 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 124610642 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 39 (A39E)
Ref Sequence ENSEMBL: ENSMUSP00000053274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053604]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000053604
AA Change: A39E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053274
Gene: ENSMUSG00000051219
AA Change: A39E

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184062
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,749 N231I possibly damaging Het
Alpk2 T C 18: 65,307,740 E661G probably damaging Het
Ankrd26 C T 6: 118,507,788 S1496N probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atp12a T C 14: 56,384,188 V760A possibly damaging Het
Casp2 T C 6: 42,279,836 C343R probably damaging Het
Cblb T A 16: 52,152,644 M446K possibly damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Ddit4l A G 3: 137,626,121 K83E probably benign Het
E430018J23Rik A G 7: 127,393,423 M5T probably benign Het
Epc2 A G 2: 49,522,669 T220A probably damaging Het
Epha5 T C 5: 84,071,191 D741G probably damaging Het
Flg2 A T 3: 93,201,761 R365S possibly damaging Het
Ggn A T 7: 29,172,668 H491L possibly damaging Het
Gm21119 T C 8: 20,621,939 S267P probably benign Het
Gm8332 A T 12: 88,249,705 D132E unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ighv6-4 A G 12: 114,406,532 V100A probably benign Het
Invs A T 4: 48,402,870 Y501F possibly damaging Het
Iqcm G T 8: 75,753,352 G313W probably damaging Het
Jph2 A G 2: 163,376,286 S157P probably damaging Het
Mast4 T C 13: 102,737,496 E1596G probably damaging Het
Mllt6 T A 11: 97,676,934 L759Q probably damaging Het
Nalcn A G 14: 123,321,323 L837P probably damaging Het
Neb G A 2: 52,147,189 T6836I probably damaging Het
Nol12 T A 15: 78,940,080 D133E probably benign Het
Olfr1136 A G 2: 87,693,570 V104A probably benign Het
Oxtr C A 6: 112,477,099 probably benign Het
Pcmt1 A G 10: 7,663,149 L38P probably damaging Het
Pik3r2 T C 8: 70,769,173 Y617C probably damaging Het
Prl7a2 T C 13: 27,661,041 N121D probably benign Het
Pvr G T 7: 19,905,802 Q380K probably benign Het
Rtn2 A G 7: 19,287,259 E188G probably benign Het
Setd4 C A 16: 93,590,030 R260L probably benign Het
Six5 A G 7: 19,096,569 N374D probably benign Het
Slc9b1 T C 3: 135,371,965 I140T probably damaging Het
Supt16 A G 14: 52,172,063 F797L probably damaging Het
Tbata T C 10: 61,185,363 L262P probably damaging Het
Tti1 A T 2: 158,008,427 C297* probably null Het
Ush1c C A 7: 46,225,624 G139C probably damaging Het
Vmn1r1 C T 1: 182,157,777 V108I probably benign Het
Vmn2r116 C T 17: 23,401,092 T600I probably damaging Het
Zfp873 A G 10: 82,060,589 T422A probably benign Het
Zfp943 G A 17: 21,992,908 C325Y probably damaging Het
Other mutations in 3100002H09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:3100002H09Rik APN 4 124610691 missense probably damaging 0.99
IGL01363:3100002H09Rik APN 4 124610690 missense probably damaging 0.99
IGL02139:3100002H09Rik APN 4 124610576 missense unknown
IGL02641:3100002H09Rik APN 4 124610717 missense unknown
R0104:3100002H09Rik UTSW 4 124610676 missense probably damaging 0.99
R1522:3100002H09Rik UTSW 4 124610694 missense probably damaging 0.99
R5590:3100002H09Rik UTSW 4 124610487 missense unknown
R6136:3100002H09Rik UTSW 4 124610388 missense unknown
R6251:3100002H09Rik UTSW 4 124610652 missense probably damaging 0.99
R8709:3100002H09Rik UTSW 4 124610523 missense unknown
R9478:3100002H09Rik UTSW 4 124610358 missense unknown
Z1176:3100002H09Rik UTSW 4 124610705 missense unknown
Predicted Primers PCR Primer
(F):5'- AAAATACACTTTTGGGGTTAGCCC -3'
(R):5'- CCACATCTGGACACCATGAG -3'

Sequencing Primer
(F):5'- TGCAACTCGGGCCTATGG -3'
(R):5'- CCATGAGTACTTATGGGTAGACTC -3'
Posted On 2018-07-23