Mutagenetix > Incidental Mutations

Incidental Mutation 'R0568:Smc4'

46250

Institutional Source

Beutler Lab

Gene Symbol

Smc4

Ensembl Gene

ENSMUSG00000034349

Gene Name

structural maintenance of chromosomes 4

Synonyms

2500002A22Rik, Smc4l1

MMRRC Submission

038759-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.971) question?

Stock #

R0568 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69004738-69034623 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 69022461 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000103433 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042901] [ENSMUST00000107803] [ENSMUST00000136502] [ENSMUST00000148385] [ENSMUST00000195525]

AlphaFold

Q8CG47

Predicted Effect

probably null
Transcript: ENSMUST00000042901

SMART Domains

Protein: ENSMUSP00000047872
Gene: ENSMUSG00000034349

Domain	Start	End	E-Value	Type
PDB:1W1W\|D	89	238	1e-17	PDB
Blast:AAA	104	238	3e-6	BLAST
low complexity region	408	427	N/A	INTRINSIC
low complexity region	447	460	N/A	INTRINSIC
low complexity region	473	482	N/A	INTRINSIC
low complexity region	545	567	N/A	INTRINSIC
SMC_hinge	611	726	1.12e-31	SMART
low complexity region	870	881	N/A	INTRINSIC
low complexity region	942	953	N/A	INTRINSIC
Blast:AAA	1102	1276	5e-26	BLAST
PDB:3KTA\|D	1125	1276	3e-30	PDB
SCOP:d1e69a_	1188	1263	3e-5	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000107803

SMART Domains

Protein: ENSMUSP00000103433
Gene: ENSMUSG00000034349

Domain	Start	End	E-Value	Type
Pfam:AAA_23	59	329	1.3e-12	PFAM
Pfam:AAA_21	81	199	5.2e-7	PFAM
coiled coil region	369	482	N/A	INTRINSIC
coiled coil region	511	563	N/A	INTRINSIC
SMC_hinge	586	701	8.6e-36	SMART
Pfam:SMC_N	738	1247	1.1e-35	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124983

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128134

Predicted Effect

probably benign
Transcript: ENSMUST00000136502

SMART Domains

Protein: ENSMUSP00000115033
Gene: ENSMUSG00000034349

Domain	Start	End	E-Value	Type
Pfam:SMC_N	81	303	1.2e-42	PFAM
Pfam:AAA_23	84	336	2.6e-16	PFAM
Pfam:AAA_21	106	227	1e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000148385

Predicted Effect

probably benign
Transcript: ENSMUST00000149174

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156354

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194693

Predicted Effect

probably benign
Transcript: ENSMUST00000195525

Meta Mutation Damage Score

0.9590

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.4%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the 'structural maintenance of chromosomes' (SMC) gene family. Members of this gene family play a role in two changes in chromosome structure during mitotic segregation of chromosomes- chromosome condensation and sister chromatid cohesion. The protein encoded by this gene is likely a subunit of the 13S condensin complex, which is involved in chromosome condensation. A pseudogene related to this gene is located on chromosome 2. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	C	T	10: 77,983,038	T181I	possibly damaging	Het
1810043G02Rik	A	T	10: 77,984,547	*250C	probably null	Het
Acnat1	G	A	4: 49,451,003	T36I	possibly damaging	Het
Adamts20	T	C	15: 94,291,713		probably benign	Het
Adamtsl1	T	C	4: 86,418,552	L1558S	probably damaging	Het
Ap3b2	A	G	7: 81,464,629		probably null	Het
Bag2	T	C	1: 33,746,978	M88V	probably benign	Het
Brms1l	A	G	12: 55,861,388		probably null	Het
C8b	A	G	4: 104,793,380	I462V	probably benign	Het
Cnpy4	A	G	5: 138,192,577	E167G	probably damaging	Het
Copa	T	C	1: 172,112,137	V624A	possibly damaging	Het
Gm4553	G	T	7: 142,165,620	P24T	unknown	Het
Gna12	A	G	5: 140,760,883	V269A	possibly damaging	Het
Gtf2ird2	G	T	5: 134,211,242	E302*	probably null	Het
Hmcn2	C	A	2: 31,415,236	S3140R	probably benign	Het
Hspa4	A	G	11: 53,262,876		probably benign	Het
Hspbp1	A	T	7: 4,684,432	L60*	probably null	Het
Lats1	A	T	10: 7,712,528	I970F	possibly damaging	Het
Lipo3	T	C	19: 33,582,042		probably benign	Het
Lrrc3	T	A	10: 77,901,585	R6W	probably damaging	Het
Lxn	C	T	3: 67,461,002	A143T	probably damaging	Het
Mga	T	C	2: 119,935,422	I1390T	probably damaging	Het
Ncapg2	T	A	12: 116,423,215	I286N	probably damaging	Het
Olfr1212	T	A	2: 88,959,043	Y192*	probably null	Het
Papd4	A	G	13: 93,154,992	S381P	probably benign	Het
Pitpnm2	A	G	5: 124,140,517		probably benign	Het
Plxna2	T	C	1: 194,751,386	V581A	probably benign	Het
Polr3d	A	T	14: 70,439,519	H378Q	possibly damaging	Het
Ptpn13	T	C	5: 103,489,765	V173A	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syngr3	C	T	17: 24,686,581	A140T	probably benign	Het
Tprn	T	C	2: 25,264,321	V545A	probably damaging	Het
Trim66	T	C	7: 109,460,695	H828R	probably benign	Het
Ugt2b5	G	A	5: 87,137,365		probably benign	Het
Vps9d1	A	G	8: 123,246,748	V432A	probably damaging	Het
Zswim9	A	T	7: 13,261,026	D401E	probably damaging	Het

Other mutations in Smc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Smc4	APN	3	69030379	missense	probably damaging	0.98
IGL00542:Smc4	APN	3	69028438	splice site	probably benign
IGL01104:Smc4	APN	3	69027584	missense	possibly damaging	0.95
IGL01380:Smc4	APN	3	69025828	missense	probably damaging	1.00
IGL01397:Smc4	APN	3	69031544	missense	probably benign
IGL02441:Smc4	APN	3	69006211	missense	probably damaging	1.00
IGL02629:Smc4	APN	3	69025873	missense	probably damaging	0.96
IGL03220:Smc4	APN	3	69009542	missense	possibly damaging	0.67
pyrrhic	UTSW	3	69027502	missense	probably damaging	1.00
R0452:Smc4	UTSW	3	69008028	nonsense	probably null
R0523:Smc4	UTSW	3	69025888	missense	probably damaging	1.00
R0571:Smc4	UTSW	3	69024289	missense	probably damaging	1.00
R0602:Smc4	UTSW	3	69009538	missense	probably damaging	1.00
R0925:Smc4	UTSW	3	69006215	critical splice donor site	probably benign
R0963:Smc4	UTSW	3	69025926	missense	probably damaging	1.00
R1540:Smc4	UTSW	3	69016772	missense	probably damaging	1.00
R1755:Smc4	UTSW	3	69034108	missense	probably damaging	1.00
R1920:Smc4	UTSW	3	69033068	missense	probably damaging	1.00
R4226:Smc4	UTSW	3	69031467	missense	probably benign	0.01
R4510:Smc4	UTSW	3	69016647	splice site	probably null
R4511:Smc4	UTSW	3	69016647	splice site	probably null
R4899:Smc4	UTSW	3	69031811	missense	probably damaging	0.97
R4967:Smc4	UTSW	3	69018239	intron	probably benign
R5096:Smc4	UTSW	3	69021279	missense	probably damaging	1.00
R5101:Smc4	UTSW	3	69028512	missense	probably benign	0.00
R5588:Smc4	UTSW	3	69025857	missense	probably benign
R5631:Smc4	UTSW	3	69030312	missense	probably benign	0.16
R5633:Smc4	UTSW	3	69008110	missense	probably damaging	1.00
R6229:Smc4	UTSW	3	69030247	nonsense	probably null
R6300:Smc4	UTSW	3	69027891	missense	probably benign	0.00
R6554:Smc4	UTSW	3	69029515	missense	probably benign	0.00
R6596:Smc4	UTSW	3	69025893	missense	probably damaging	1.00
R6603:Smc4	UTSW	3	69022461	critical splice donor site	probably null
R6682:Smc4	UTSW	3	69007241	missense	probably damaging	0.98
R6727:Smc4	UTSW	3	69016772	missense	probably damaging	1.00
R6955:Smc4	UTSW	3	69024309	missense	possibly damaging	0.95
R7037:Smc4	UTSW	3	69018195	missense	possibly damaging	0.67
R7051:Smc4	UTSW	3	69027502	missense	probably damaging	1.00
R7454:Smc4	UTSW	3	69018124	missense	probably benign
R7630:Smc4	UTSW	3	69018067	critical splice acceptor site	probably benign
R7632:Smc4	UTSW	3	69018067	critical splice acceptor site	probably benign
R7633:Smc4	UTSW	3	69018067	critical splice acceptor site	probably benign
R7773:Smc4	UTSW	3	69016163	missense	probably damaging	1.00
R7857:Smc4	UTSW	3	69033219	missense	possibly damaging	0.61
R8008:Smc4	UTSW	3	69007312	missense	probably damaging	0.99
R8398:Smc4	UTSW	3	69025851	missense	probably damaging	1.00
R8527:Smc4	UTSW	3	69032891	critical splice donor site	probably null
R8936:Smc4	UTSW	3	69018158	missense	probably benign	0.21
R8998:Smc4	UTSW	3	69027561	utr 3 prime	probably benign
R9267:Smc4	UTSW	3	69034453	missense	probably damaging	1.00
X0063:Smc4	UTSW	3	69018103	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- TCAAAGATGGAAGTTGCTCAGTCAGAAC -3'
(R):5'- GGAGGTGGTGGGGATGTCTAACTAA -3'

Sequencing Primer
(F):5'- TCAGAACTTGATATCTATCTCAGTCG -3'
(R):5'- agccatctctccagccc -3'

Posted On

2013-06-11