Incidental Mutation 'R6813:Vamp5'
ID533942
Institutional Source Beutler Lab
Gene Symbol Vamp5
Ensembl Gene ENSMUSG00000073002
Gene Namevesicle-associated membrane protein 5
SynonymsCamp
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.376) question?
Stock #R6813 (G1)
Quality Score94.0077
Status Validated
Chromosome6
Chromosomal Location72368794-72380468 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 72380441 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059983] [ENSMUST00000074231] [ENSMUST00000101285] [ENSMUST00000142613]
Predicted Effect probably benign
Transcript: ENSMUST00000059983
SMART Domains Protein: ENSMUSP00000059501
Gene: ENSMUSG00000050732

DomainStartEndE-ValueType
Pfam:Synaptobrevin 9 97 1.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074231
SMART Domains Protein: ENSMUSP00000073852
Gene: ENSMUSG00000073002

DomainStartEndE-ValueType
Pfam:Synaptobrevin 2 90 1.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101285
SMART Domains Protein: ENSMUSP00000098843
Gene: ENSMUSG00000073002

DomainStartEndE-ValueType
Pfam:Synaptobrevin 2 90 1.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142613
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.9%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Synaptobrevins/VAMPs, syntaxins, and the 25-kD synaptosomal-associated protein are the main components of a protein complex involved in the docking and/or fusion of vesicles and cell membranes. The VAMP5 gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family and the SNARE superfamily. This VAMP family member may participate in vesicle trafficking events that are associated with myogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,229,282 N2337K probably benign Het
Adgrb2 C A 4: 130,009,491 Q603K probably damaging Het
Adgrf3 A G 5: 30,197,521 F503S probably damaging Het
Arfgap3 A T 15: 83,330,593 M164K probably benign Het
Asb13 G T 13: 3,645,029 V166F probably damaging Het
Atm T G 9: 53,497,235 R1103S probably benign Het
Atxn7l1 T C 12: 33,367,124 I626T probably damaging Het
Brsk2 A G 7: 142,002,477 I649V probably benign Het
Ccdc25 T A 14: 65,856,433 M85K probably benign Het
Cdc42bpb A G 12: 111,327,615 V231A probably damaging Het
Clstn3 T A 6: 124,436,935 M767L probably benign Het
Col6a6 C T 9: 105,783,941 R323K probably benign Het
Creld1 A G 6: 113,489,569 Y199C probably damaging Het
Csf1r T A 18: 61,112,734 D254E probably benign Het
Dab2ip C T 2: 35,730,473 Q1118* probably null Het
Dcun1d4 C A 5: 73,520,957 S98R possibly damaging Het
Disp3 G A 4: 148,259,930 P505L probably benign Het
Dlec1 A T 9: 119,112,102 Q240L probably benign Het
Edil3 T A 13: 89,289,456 I392N probably damaging Het
Epha10 T A 4: 124,902,693 S398R Het
Ephb1 A G 9: 102,010,048 I464T possibly damaging Het
Eps15 T A 4: 109,280,402 probably null Het
Fam111a T A 19: 12,587,342 C152S probably damaging Het
Flt3 T C 5: 147,354,843 E599G probably damaging Het
Frmd3 T C 4: 74,159,245 S259P probably benign Het
Gm15922 T C 7: 3,736,003 H535R probably benign Het
Gm30302 T A 13: 49,787,396 R279S probably benign Het
Hsfy2 A G 1: 56,636,302 Y359H possibly damaging Het
Ifih1 C T 2: 62,645,693 V80M possibly damaging Het
Il12rb2 A C 6: 67,292,374 D818E probably damaging Het
Il4i1 A G 7: 44,839,812 T334A probably benign Het
Irs2 G A 8: 11,004,659 Q1258* probably null Het
Lsm1 T G 8: 25,793,693 H44Q probably benign Het
Mgam A T 6: 40,750,165 M1257L probably damaging Het
Myc T C 15: 61,988,152 S225P probably damaging Het
Myh1 T C 11: 67,220,460 V1575A probably benign Het
Myo9b A G 8: 71,323,305 D380G probably damaging Het
Ncoa7 T A 10: 30,696,192 D157V probably damaging Het
Olfr314 G T 11: 58,786,646 Q137H probably benign Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr877 A C 9: 37,855,514 E232A possibly damaging Het
Olfr883 T C 9: 38,025,833 V9A probably damaging Het
Olfr980 T A 9: 40,006,457 H164L probably benign Het
Pccb A G 9: 101,023,215 V117A probably damaging Het
Pdp2 C T 8: 104,594,499 H327Y probably damaging Het
Pdzph1 G T 17: 58,974,436 Q284K probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Phldb1 A T 9: 44,699,568 S751R probably damaging Het
Ppp1r1b T A 11: 98,349,176 probably null Het
Ppp1r3a A G 6: 14,719,571 V448A probably benign Het
Pvrig A T 5: 138,342,050 T28S probably benign Het
Rasgrf1 G A 9: 90,010,484 probably null Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Slc30a7 A T 3: 115,981,811 D221E probably benign Het
Tmem30c A G 16: 57,281,259 probably null Het
Tmem33 T C 5: 67,264,459 probably null Het
Ttc29 A T 8: 78,333,620 T390S probably benign Het
Vmn2r81 T A 10: 79,268,605 F354Y probably benign Het
Vmn2r96 A G 17: 18,581,854 H119R probably benign Het
Wdr3 G A 3: 100,138,725 R931* probably null Het
Wdr78 T C 4: 103,048,326 K753E probably benign Het
Wtap A T 17: 12,967,510 N383K probably damaging Het
Zfp808 T C 13: 62,173,035 Y693H probably damaging Het
Other mutations in Vamp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0782:Vamp5 UTSW 6 72369470 missense probably damaging 0.97
R2937:Vamp5 UTSW 6 72369340 missense probably benign 0.20
R2938:Vamp5 UTSW 6 72369340 missense probably benign 0.20
R4894:Vamp5 UTSW 6 72370198 missense possibly damaging 0.93
R6814:Vamp5 UTSW 6 72380441 unclassified probably benign
R6825:Vamp5 UTSW 6 72380441 unclassified probably benign
R6853:Vamp5 UTSW 6 72380441 unclassified probably benign
R6858:Vamp5 UTSW 6 72380441 unclassified probably benign
R8073:Vamp5 UTSW 6 72380453 unclassified probably benign
R8354:Vamp5 UTSW 6 72370393 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCTGATAACTGCTCCAGGAG -3'
(R):5'- TGTCATCGGAAATCGGACGC -3'

Sequencing Primer
(F):5'- GAAGCTGTAGCACCGCTCAC -3'
(R):5'- AAATCGGACGCCTGTGG -3'
Posted On2018-09-12