Incidental Mutation 'R6813:Ifih1'
ID 533927
Institutional Source Beutler Lab
Gene Symbol Ifih1
Ensembl Gene ENSMUSG00000026896
Gene Name interferon induced with helicase C domain 1
Synonyms MDA5, Helicard, 9130009C22Rik, MDA-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R6813 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 62595798-62646255 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 62645693 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 80 (V80M)
Ref Sequence ENSEMBL: ENSMUSP00000028259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028259] [ENSMUST00000112459]
AlphaFold Q8R5F7
PDB Structure Crystal Structure of the MDA5 Helicase Insert Domain [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028259
AA Change: V80M

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028259
Gene: ENSMUSG00000026896
AA Change: V80M

DomainStartEndE-ValueType
Pfam:CARD_2 7 99 3e-22 PFAM
Pfam:CARD_2 110 200 6.8e-22 PFAM
Pfam:CARD 115 200 2.6e-15 PFAM
low complexity region 248 261 N/A INTRINSIC
DEXDc 305 520 1.08e-26 SMART
Blast:DEXDc 590 712 1e-45 BLAST
HELICc 742 826 1.27e-14 SMART
Pfam:RIG-I_C-RD 903 1018 4.2e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112459
AA Change: V80M

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108078
Gene: ENSMUSG00000026896
AA Change: V80M

DomainStartEndE-ValueType
SCOP:d3ygsp_ 6 88 1e-3 SMART
Pfam:CARD 115 200 3.9e-15 PFAM
DEXDc 256 471 1.08e-26 SMART
Blast:DEXDc 541 663 1e-45 BLAST
HELICc 693 777 1.27e-14 SMART
Pfam:RIG-I_C-RD 852 973 1.5e-43 PFAM
Meta Mutation Damage Score 0.0923 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.9%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein that is upregulated in response to treatment with beta-interferon and a protein kinase C-activating compound, mezerein. Irreversible reprogramming of melanomas can be achieved by treatment with both these agents; treatment with either agent alone only achieves reversible differentiation. Genetic variation in this gene is associated with diabetes mellitus insulin-dependent type 19. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele have increased virus-associated morbidity and mortality, and decreased cytokine response to several viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,229,282 N2337K probably benign Het
Adgrb2 C A 4: 130,009,491 Q603K probably damaging Het
Adgrf3 A G 5: 30,197,521 F503S probably damaging Het
Arfgap3 A T 15: 83,330,593 M164K probably benign Het
Asb13 G T 13: 3,645,029 V166F probably damaging Het
Atm T G 9: 53,497,235 R1103S probably benign Het
Atxn7l1 T C 12: 33,367,124 I626T probably damaging Het
Brsk2 A G 7: 142,002,477 I649V probably benign Het
Ccdc25 T A 14: 65,856,433 M85K probably benign Het
Cdc42bpb A G 12: 111,327,615 V231A probably damaging Het
Clstn3 T A 6: 124,436,935 M767L probably benign Het
Col6a6 C T 9: 105,783,941 R323K probably benign Het
Creld1 A G 6: 113,489,569 Y199C probably damaging Het
Csf1r T A 18: 61,112,734 D254E probably benign Het
Dab2ip C T 2: 35,730,473 Q1118* probably null Het
Dcun1d4 C A 5: 73,520,957 S98R possibly damaging Het
Disp3 G A 4: 148,259,930 P505L probably benign Het
Dlec1 A T 9: 119,112,102 Q240L probably benign Het
Edil3 T A 13: 89,289,456 I392N probably damaging Het
Epha10 T A 4: 124,902,693 S398R Het
Ephb1 A G 9: 102,010,048 I464T possibly damaging Het
Eps15 T A 4: 109,280,402 probably null Het
Fam111a T A 19: 12,587,342 C152S probably damaging Het
Flt3 T C 5: 147,354,843 E599G probably damaging Het
Frmd3 T C 4: 74,159,245 S259P probably benign Het
Gm15922 T C 7: 3,736,003 H535R probably benign Het
Gm30302 T A 13: 49,787,396 R279S probably benign Het
Hsfy2 A G 1: 56,636,302 Y359H possibly damaging Het
Il12rb2 A C 6: 67,292,374 D818E probably damaging Het
Il4i1 A G 7: 44,839,812 T334A probably benign Het
Irs2 G A 8: 11,004,659 Q1258* probably null Het
Lsm1 T G 8: 25,793,693 H44Q probably benign Het
Mgam A T 6: 40,750,165 M1257L probably damaging Het
Myc T C 15: 61,988,152 S225P probably damaging Het
Myh1 T C 11: 67,220,460 V1575A probably benign Het
Myo9b A G 8: 71,323,305 D380G probably damaging Het
Ncoa7 T A 10: 30,696,192 D157V probably damaging Het
Olfr314 G T 11: 58,786,646 Q137H probably benign Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr877 A C 9: 37,855,514 E232A possibly damaging Het
Olfr883 T C 9: 38,025,833 V9A probably damaging Het
Olfr980 T A 9: 40,006,457 H164L probably benign Het
Pccb A G 9: 101,023,215 V117A probably damaging Het
Pdp2 C T 8: 104,594,499 H327Y probably damaging Het
Pdzph1 G T 17: 58,974,436 Q284K probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Phldb1 A T 9: 44,699,568 S751R probably damaging Het
Ppp1r1b T A 11: 98,349,176 probably null Het
Ppp1r3a A G 6: 14,719,571 V448A probably benign Het
Pvrig A T 5: 138,342,050 T28S probably benign Het
Rasgrf1 G A 9: 90,010,484 probably null Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Slc30a7 A T 3: 115,981,811 D221E probably benign Het
Tmem30c A G 16: 57,281,259 probably null Het
Tmem33 T C 5: 67,264,459 probably null Het
Ttc29 A T 8: 78,333,620 T390S probably benign Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r81 T A 10: 79,268,605 F354Y probably benign Het
Vmn2r96 A G 17: 18,581,854 H119R probably benign Het
Wdr3 G A 3: 100,138,725 R931* probably null Het
Wdr78 T C 4: 103,048,326 K753E probably benign Het
Wtap A T 17: 12,967,510 N383K probably damaging Het
Zfp808 T C 13: 62,173,035 Y693H probably damaging Het
Other mutations in Ifih1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Ifih1 APN 2 62645870 missense probably damaging 1.00
IGL00832:Ifih1 APN 2 62645470 splice site probably benign
IGL00906:Ifih1 APN 2 62645824 missense probably benign
IGL01664:Ifih1 APN 2 62611700 splice site probably benign
IGL01820:Ifih1 APN 2 62617313 missense probably damaging 1.00
IGL02016:Ifih1 APN 2 62606984 missense probably benign 0.01
IGL02298:Ifih1 APN 2 62610439 critical splice donor site probably null
IGL02311:Ifih1 APN 2 62610503 missense probably damaging 1.00
IGL02635:Ifih1 APN 2 62611829 missense probably damaging 1.00
Washington UTSW 2 62598799 missense possibly damaging 0.88
R0514:Ifih1 UTSW 2 62623391 critical splice donor site probably null
R1329:Ifih1 UTSW 2 62617487 splice site probably null
R1484:Ifih1 UTSW 2 62610558 missense probably benign 0.00
R1769:Ifih1 UTSW 2 62606394 missense probably damaging 1.00
R2104:Ifih1 UTSW 2 62610545 nonsense probably null
R2125:Ifih1 UTSW 2 62623467 missense probably benign 0.43
R2126:Ifih1 UTSW 2 62623467 missense probably benign 0.43
R2406:Ifih1 UTSW 2 62607103 splice site probably benign
R3919:Ifih1 UTSW 2 62623501 splice site probably benign
R4033:Ifih1 UTSW 2 62635190 missense probably benign
R4060:Ifih1 UTSW 2 62598799 missense possibly damaging 0.88
R4435:Ifih1 UTSW 2 62645890 missense probably damaging 1.00
R4538:Ifih1 UTSW 2 62617412 missense probably damaging 1.00
R4663:Ifih1 UTSW 2 62609219 missense probably benign 0.00
R4703:Ifih1 UTSW 2 62598876 missense probably benign 0.05
R4897:Ifih1 UTSW 2 62635014 intron probably benign
R5274:Ifih1 UTSW 2 62611718 missense probably benign 0.00
R5949:Ifih1 UTSW 2 62610560 missense probably benign 0.05
R6140:Ifih1 UTSW 2 62601460 missense possibly damaging 0.77
R6223:Ifih1 UTSW 2 62598259 missense probably benign
R6332:Ifih1 UTSW 2 62639483 missense possibly damaging 0.64
R6650:Ifih1 UTSW 2 62606447 missense possibly damaging 0.69
R6977:Ifih1 UTSW 2 62606186 missense probably damaging 1.00
R7054:Ifih1 UTSW 2 62610515 missense probably benign 0.30
R7167:Ifih1 UTSW 2 62598896 missense probably benign
R7269:Ifih1 UTSW 2 62645633 missense probably benign 0.00
R7397:Ifih1 UTSW 2 62623488 missense possibly damaging 0.85
R7885:Ifih1 UTSW 2 62601469 missense possibly damaging 0.96
R8672:Ifih1 UTSW 2 62605649 missense possibly damaging 0.82
R8960:Ifih1 UTSW 2 62611891 missense possibly damaging 0.89
R9258:Ifih1 UTSW 2 62611898 missense probably damaging 1.00
R9324:Ifih1 UTSW 2 62645606 missense probably benign
R9432:Ifih1 UTSW 2 62609274 missense probably damaging 1.00
Z1176:Ifih1 UTSW 2 62617469 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCGAAGCAAGTGTCCAAG -3'
(R):5'- AGAGGACAGCTTCAGGAATCTC -3'

Sequencing Primer
(F):5'- GCAAGTGTCCAAGACATCGTTAATC -3'
(R):5'- GGCCCAGGCTGAAAATGTACATTC -3'
Posted On 2018-09-12