Incidental Mutation 'R6889:Zfp532'
ID 537141
Institutional Source Beutler Lab
Gene Symbol Zfp532
Ensembl Gene ENSMUSG00000042439
Gene Name zinc finger protein 532
Synonyms C530030I18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock # R6889 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 65580230-65689443 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65686990 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 882 (E882G)
Ref Sequence ENSEMBL: ENSMUSP00000129390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049016] [ENSMUST00000169679] [ENSMUST00000182478] [ENSMUST00000182852]
AlphaFold Q6NXK2
Predicted Effect possibly damaging
Transcript: ENSMUST00000049016
AA Change: E882G

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036582
Gene: ENSMUSG00000042439
AA Change: E882G

DomainStartEndE-ValueType
low complexity region 253 287 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
low complexity region 395 417 N/A INTRINSIC
low complexity region 480 502 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
ZnF_C2H2 615 635 7.18e1 SMART
ZnF_C2H2 643 667 1.23e1 SMART
low complexity region 726 738 N/A INTRINSIC
ZnF_C2H2 751 772 4.57e0 SMART
ZnF_C2H2 784 807 1.25e-1 SMART
ZnF_C2H2 814 840 1.43e-1 SMART
low complexity region 860 872 N/A INTRINSIC
ZnF_C2H2 909 931 1.31e0 SMART
ZnF_C2H2 938 961 9.44e-2 SMART
ZnF_C2H2 999 1021 6.88e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169679
AA Change: E882G

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129390
Gene: ENSMUSG00000042439
AA Change: E882G

DomainStartEndE-ValueType
low complexity region 253 287 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
low complexity region 395 417 N/A INTRINSIC
low complexity region 480 502 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
ZnF_C2H2 615 635 7.18e1 SMART
ZnF_C2H2 643 667 1.23e1 SMART
low complexity region 726 738 N/A INTRINSIC
ZnF_C2H2 751 772 4.57e0 SMART
ZnF_C2H2 784 807 1.25e-1 SMART
ZnF_C2H2 814 840 1.43e-1 SMART
low complexity region 860 872 N/A INTRINSIC
ZnF_C2H2 909 931 1.31e0 SMART
ZnF_C2H2 938 961 9.44e-2 SMART
ZnF_C2H2 999 1021 6.88e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182478
SMART Domains Protein: ENSMUSP00000138315
Gene: ENSMUSG00000042439

DomainStartEndE-ValueType
low complexity region 253 287 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
low complexity region 395 417 N/A INTRINSIC
low complexity region 480 502 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
ZnF_C2H2 615 635 7.18e1 SMART
ZnF_C2H2 643 667 1.23e1 SMART
low complexity region 726 738 N/A INTRINSIC
ZnF_C2H2 751 772 4.57e0 SMART
ZnF_C2H2 780 802 4.34e0 SMART
ZnF_C2H2 808 832 1.55e1 SMART
ZnF_C2H2 839 862 8.94e-3 SMART
ZnF_C2H2 867 890 3.78e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182852
AA Change: E1150G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138663
Gene: ENSMUSG00000042439
AA Change: E1150G

DomainStartEndE-ValueType
low complexity region 253 287 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
low complexity region 395 417 N/A INTRINSIC
low complexity region 480 502 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
ZnF_C2H2 615 635 7.18e1 SMART
ZnF_C2H2 643 667 1.23e1 SMART
low complexity region 726 738 N/A INTRINSIC
ZnF_C2H2 751 772 4.57e0 SMART
ZnF_C2H2 780 802 4.34e0 SMART
ZnF_C2H2 808 832 1.55e1 SMART
ZnF_C2H2 839 862 8.94e-3 SMART
ZnF_C2H2 867 890 3.78e-1 SMART
ZnF_C2H2 902 924 7.15e-2 SMART
ZnF_C2H2 933 956 1.43e-1 SMART
ZnF_C2H2 1022 1045 4.72e-2 SMART
ZnF_C2H2 1052 1075 1.25e-1 SMART
ZnF_C2H2 1082 1108 1.43e-1 SMART
low complexity region 1128 1140 N/A INTRINSIC
ZnF_C2H2 1177 1199 1.31e0 SMART
ZnF_C2H2 1206 1229 9.44e-2 SMART
ZnF_C2H2 1267 1289 6.88e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,943,053 D103E probably benign Het
Abcc3 A T 11: 94,375,555 S70T possibly damaging Het
Atp6v0a1 A G 11: 101,029,183 Y214C possibly damaging Het
Azi2 A G 9: 118,049,895 probably null Het
BC067074 C A 13: 113,318,378 S319R probably damaging Het
Cacnb2 T A 2: 14,986,015 V636E possibly damaging Het
Cd8a A C 6: 71,374,562 T169P probably damaging Het
Cfap44 G A 16: 44,404,132 V68I probably benign Het
Eea1 G T 10: 96,037,478 C1134F probably benign Het
Ehmt2 T G 17: 34,912,772 F1192V probably damaging Het
Emc1 T C 4: 139,365,350 F531L probably damaging Het
Eme1 G A 11: 94,650,477 T173I probably benign Het
Gli2 A T 1: 118,844,416 C520S probably damaging Het
Gm43302 T C 5: 105,280,138 K186E probably benign Het
Gpr108 A T 17: 57,236,990 N405K probably damaging Het
Hmgcl C A 4: 135,955,642 T135N probably benign Het
Hydin G A 8: 110,532,856 D2487N possibly damaging Het
Igfl3 G T 7: 18,179,800 R25L probably benign Het
Igsf10 A C 3: 59,331,933 S276A probably benign Het
Kctd1 A G 18: 14,973,988 S211P probably damaging Het
Kctd7 A T 5: 130,152,501 Q255L probably benign Het
Lrig1 A G 6: 94,625,063 Y270H probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A G 16: 49,153,111 N1248S possibly damaging Het
Nod1 A G 6: 54,944,109 F408S probably benign Het
Nrp1 T C 8: 128,493,057 F652S probably damaging Het
Olfr1338 G A 4: 118,754,307 T79I probably damaging Het
Olfr487 A T 7: 108,211,918 F204I probably benign Het
Olfr574 A T 7: 102,948,768 H91L possibly damaging Het
Olfr821 T C 10: 130,034,532 M302T probably benign Het
Opa1 G T 16: 29,620,868 R792L probably benign Het
Pcdha6 G T 18: 36,968,343 L196F probably damaging Het
Pdia2 A T 17: 26,196,970 Y347* probably null Het
Pdpr G T 8: 111,124,613 probably null Het
Pigt T A 2: 164,507,331 L518Q probably damaging Het
Ppfibp2 A C 7: 107,737,981 D591A possibly damaging Het
Prrg2 G A 7: 45,059,989 T97M possibly damaging Het
Qars A G 9: 108,513,183 T428A probably damaging Het
Rai1 T C 11: 60,185,715 F202L probably damaging Het
Rars A T 11: 35,808,486 M660K probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a6 A C 11: 109,455,040 F382V probably damaging Het
Slc30a7 T C 3: 115,954,153 T330A probably damaging Het
Smc1b A T 15: 85,067,759 L1157Q probably damaging Het
Snx4 G T 16: 33,251,470 A4S possibly damaging Het
Sv2b A C 7: 75,125,767 probably null Het
Syt9 A T 7: 107,425,286 I129L probably damaging Het
Ttbk2 T C 2: 120,773,353 E198G probably damaging Het
Ubr3 A T 2: 69,944,300 D488V possibly damaging Het
Ush2a T A 1: 188,797,871 C3286S probably damaging Het
Vill A G 9: 119,065,882 D56G possibly damaging Het
Vmn1r41 A T 6: 89,747,370 I298F probably damaging Het
Vmn2r2 A T 3: 64,117,267 V631D probably damaging Het
Vmn2r32 A G 7: 7,472,574 S437P possibly damaging Het
Vmn2r53 A G 7: 12,601,142 V197A probably benign Het
Wasf1 A T 10: 40,920,369 I32F probably damaging Het
Wasf2 G T 4: 133,194,730 A387S unknown Het
Wdr92 G A 11: 17,222,309 V133M probably damaging Het
Zbtb14 G A 17: 69,387,679 C124Y probably damaging Het
Zfp462 G T 4: 55,007,671 A37S probably damaging Het
Other mutations in Zfp532
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02341:Zfp532 APN 18 65624778 missense probably damaging 1.00
IGL02451:Zfp532 APN 18 65623601 missense probably damaging 0.96
IGL02496:Zfp532 APN 18 65624042 missense probably damaging 1.00
PIT4151001:Zfp532 UTSW 18 65624414 missense probably damaging 1.00
R0048:Zfp532 UTSW 18 65644333 missense probably damaging 1.00
R0076:Zfp532 UTSW 18 65685627 missense probably benign 0.07
R0095:Zfp532 UTSW 18 65624784 missense probably damaging 1.00
R0239:Zfp532 UTSW 18 65682985 missense possibly damaging 0.63
R0239:Zfp532 UTSW 18 65682985 missense possibly damaging 0.63
R0539:Zfp532 UTSW 18 65623766 missense probably benign 0.04
R0948:Zfp532 UTSW 18 65623818 missense probably damaging 1.00
R1447:Zfp532 UTSW 18 65624990 missense probably damaging 1.00
R1645:Zfp532 UTSW 18 65687264 missense probably benign 0.26
R1749:Zfp532 UTSW 18 65623484 missense possibly damaging 0.83
R1797:Zfp532 UTSW 18 65625144 missense probably benign 0.04
R1934:Zfp532 UTSW 18 65685611 missense probably damaging 0.97
R1959:Zfp532 UTSW 18 65624492 missense probably damaging 0.99
R2153:Zfp532 UTSW 18 65624927 missense possibly damaging 0.93
R2280:Zfp532 UTSW 18 65624712 missense probably damaging 0.96
R2281:Zfp532 UTSW 18 65624712 missense probably damaging 0.96
R2847:Zfp532 UTSW 18 65656626 missense possibly damaging 0.79
R2848:Zfp532 UTSW 18 65656626 missense possibly damaging 0.79
R4483:Zfp532 UTSW 18 65656565 missense probably benign 0.02
R4938:Zfp532 UTSW 18 65623766 missense probably benign
R4947:Zfp532 UTSW 18 65625066 missense possibly damaging 0.46
R5714:Zfp532 UTSW 18 65623535 missense possibly damaging 0.93
R5920:Zfp532 UTSW 18 65644350 missense probably benign
R6035:Zfp532 UTSW 18 65623934 missense possibly damaging 0.95
R6035:Zfp532 UTSW 18 65623934 missense possibly damaging 0.95
R6092:Zfp532 UTSW 18 65644210 missense probably damaging 1.00
R6170:Zfp532 UTSW 18 65624438 missense probably damaging 0.97
R6180:Zfp532 UTSW 18 65656471 missense probably benign
R7039:Zfp532 UTSW 18 65638763 missense probably benign 0.44
R7095:Zfp532 UTSW 18 65682898 missense probably benign
R7313:Zfp532 UTSW 18 65623005 missense probably damaging 1.00
R7400:Zfp532 UTSW 18 65638913 missense possibly damaging 0.52
R7882:Zfp532 UTSW 18 65623490 missense probably benign
R8026:Zfp532 UTSW 18 65625156 missense possibly damaging 0.66
R8444:Zfp532 UTSW 18 65624259 missense possibly damaging 0.85
R8477:Zfp532 UTSW 18 65624066 missense probably damaging 1.00
R8544:Zfp532 UTSW 18 65625156 missense possibly damaging 0.84
R8890:Zfp532 UTSW 18 65624333 missense probably damaging 1.00
R8920:Zfp532 UTSW 18 65687319 missense probably benign 0.17
R9334:Zfp532 UTSW 18 65623057 missense probably damaging 1.00
R9421:Zfp532 UTSW 18 65624237 missense probably benign 0.04
R9439:Zfp532 UTSW 18 65685643 missense probably benign 0.00
R9472:Zfp532 UTSW 18 65623553 nonsense probably null
R9477:Zfp532 UTSW 18 65644357 missense probably benign 0.01
R9616:Zfp532 UTSW 18 65656568 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AATGCTTCCTATTTGCGGGG -3'
(R):5'- CTTGTGCACGATGAAGAGGTG -3'

Sequencing Primer
(F):5'- GTGAATTCACACCGTTAAGGC -3'
(R):5'- ACGTGTAGCACAGGCCAC -3'
Posted On 2018-10-18