Incidental Mutation 'R6889:Wasf2'
ID537093
Institutional Source Beutler Lab
Gene Symbol Wasf2
Ensembl Gene ENSMUSG00000028868
Gene NameWAS protein family, member 2
SynonymsD4Ertd13e, WAVE2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6889 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location133130505-133199756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 133194730 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 387 (A387S)
Ref Sequence ENSEMBL: ENSMUSP00000101532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084241] [ENSMUST00000105912]
Predicted Effect unknown
Transcript: ENSMUST00000084241
AA Change: A387S
SMART Domains Protein: ENSMUSP00000081263
Gene: ENSMUSG00000028868
AA Change: A387S

DomainStartEndE-ValueType
PDB:4N78|D 1 219 4e-90 PDB
low complexity region 243 263 N/A INTRINSIC
low complexity region 293 403 N/A INTRINSIC
low complexity region 411 419 N/A INTRINSIC
WH2 435 452 7.02e-5 SMART
low complexity region 481 497 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000105912
AA Change: A387S
SMART Domains Protein: ENSMUSP00000101532
Gene: ENSMUSG00000028868
AA Change: A387S

DomainStartEndE-ValueType
PDB:4N78|D 1 219 4e-90 PDB
low complexity region 243 263 N/A INTRINSIC
low complexity region 293 403 N/A INTRINSIC
low complexity region 411 419 N/A INTRINSIC
WH2 435 452 7.02e-5 SMART
low complexity region 481 497 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Wiskott-Aldrich syndrome protein family. The gene product is a protein that forms a multiprotein complex that links receptor kinases and actin. Binding to actin occurs through a C-terminal verprolin homology domain in all family members. The multiprotein complex serves to tranduce signals that involve changes in cell shape, motility or function. The published map location (PMID:10381382) has been changed based on recent genomic sequence comparisons, which indicate that the expressed gene is located on chromosome 1, and a pseudogene may be located on chromosome X. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutants show impaired embryonic development and do not survive to term. In addition to reduced embryo size, observed defects include hemorrhaging, abnormal somite development, perturbed angiogenesis, and shrunken cerebral ventricles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,943,053 D103E probably benign Het
Abcc3 A T 11: 94,375,555 S70T possibly damaging Het
Atp6v0a1 A G 11: 101,029,183 Y214C possibly damaging Het
Azi2 A G 9: 118,049,895 probably null Het
BC067074 C A 13: 113,318,378 S319R probably damaging Het
Cacnb2 T A 2: 14,986,015 V636E possibly damaging Het
Cd8a A C 6: 71,374,562 T169P probably damaging Het
Cfap44 G A 16: 44,404,132 V68I probably benign Het
Eea1 G T 10: 96,037,478 C1134F probably benign Het
Ehmt2 T G 17: 34,912,772 F1192V probably damaging Het
Emc1 T C 4: 139,365,350 F531L probably damaging Het
Eme1 G A 11: 94,650,477 T173I probably benign Het
Gli2 A T 1: 118,844,416 C520S probably damaging Het
Gm43302 T C 5: 105,280,138 K186E probably benign Het
Gpr108 A T 17: 57,236,990 N405K probably damaging Het
Hmgcl C A 4: 135,955,642 T135N probably benign Het
Hydin G A 8: 110,532,856 D2487N possibly damaging Het
Igfl3 G T 7: 18,179,800 R25L probably benign Het
Igsf10 A C 3: 59,331,933 S276A probably benign Het
Kctd1 A G 18: 14,973,988 S211P probably damaging Het
Kctd7 A T 5: 130,152,501 Q255L probably benign Het
Lrig1 A G 6: 94,625,063 Y270H probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A G 16: 49,153,111 N1248S possibly damaging Het
Nod1 A G 6: 54,944,109 F408S probably benign Het
Nrp1 T C 8: 128,493,057 F652S probably damaging Het
Olfr1338 G A 4: 118,754,307 T79I probably damaging Het
Olfr487 A T 7: 108,211,918 F204I probably benign Het
Olfr574 A T 7: 102,948,768 H91L possibly damaging Het
Olfr821 T C 10: 130,034,532 M302T probably benign Het
Opa1 G T 16: 29,620,868 R792L probably benign Het
Pcdha6 G T 18: 36,968,343 L196F probably damaging Het
Pdia2 A T 17: 26,196,970 Y347* probably null Het
Pdpr G T 8: 111,124,613 probably null Het
Pigt T A 2: 164,507,331 L518Q probably damaging Het
Ppfibp2 A C 7: 107,737,981 D591A possibly damaging Het
Prrg2 G A 7: 45,059,989 T97M possibly damaging Het
Qars A G 9: 108,513,183 T428A probably damaging Het
Rai1 T C 11: 60,185,715 F202L probably damaging Het
Rars A T 11: 35,808,486 M660K probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a6 A C 11: 109,455,040 F382V probably damaging Het
Slc30a7 T C 3: 115,954,153 T330A probably damaging Het
Smc1b A T 15: 85,067,759 L1157Q probably damaging Het
Snx4 G T 16: 33,251,470 A4S possibly damaging Het
Sv2b A C 7: 75,125,767 probably null Het
Syt9 A T 7: 107,425,286 I129L probably damaging Het
Ttbk2 T C 2: 120,773,353 E198G probably damaging Het
Ubr3 A T 2: 69,944,300 D488V possibly damaging Het
Ush2a T A 1: 188,797,871 C3286S probably damaging Het
Vill A G 9: 119,065,882 D56G possibly damaging Het
Vmn1r41 A T 6: 89,747,370 I298F probably damaging Het
Vmn2r2 A T 3: 64,117,267 V631D probably damaging Het
Vmn2r32 A G 7: 7,472,574 S437P possibly damaging Het
Vmn2r53 A G 7: 12,601,142 V197A probably benign Het
Wasf1 A T 10: 40,920,369 I32F probably damaging Het
Wdr92 G A 11: 17,222,309 V133M probably damaging Het
Zbtb14 G A 17: 69,387,679 C124Y probably damaging Het
Zfp462 G T 4: 55,007,671 A37S probably damaging Het
Zfp532 A G 18: 65,686,990 E882G possibly damaging Het
Other mutations in Wasf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Wasf2 APN 4 133192128 missense unknown
IGL02028:Wasf2 APN 4 133195801 missense probably damaging 1.00
IGL03196:Wasf2 APN 4 133194421 missense unknown
IGL03225:Wasf2 APN 4 133176546 missense probably benign
Syndrome UTSW 4 133194909 critical splice donor site probably null
R1551:Wasf2 UTSW 4 133190172 missense unknown
R1646:Wasf2 UTSW 4 133176591 missense probably benign 0.25
R4776:Wasf2 UTSW 4 133185004 missense probably benign
R4929:Wasf2 UTSW 4 133195859 missense unknown
R5042:Wasf2 UTSW 4 133176564 missense probably benign 0.37
R6803:Wasf2 UTSW 4 133194909 critical splice donor site probably null
R7208:Wasf2 UTSW 4 133195734 missense probably damaging 1.00
R7421:Wasf2 UTSW 4 133185101 missense unknown
R8477:Wasf2 UTSW 4 133185101 missense unknown
R8707:Wasf2 UTSW 4 133190229 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGAGTGTGCCACCTCCACTAC -3'
(R):5'- AGCATCTCAGCTAAGGGTGC -3'

Sequencing Primer
(F):5'- CCATCGATGGGATTCGGGTCTC -3'
(R):5'- CTAAGGGTGCGTGTCCTCAGATC -3'
Posted On2018-10-18