Incidental Mutation 'R6889:Gm43302'
ID537096
Institutional Source Beutler Lab
Gene Symbol Gm43302
Ensembl Gene ENSMUSG00000079362
Gene Namepredicted gene 43302
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6889 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location105214907-105293695 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105280138 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 186 (K186E)
Ref Sequence ENSEMBL: ENSMUSP00000142518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050011] [ENSMUST00000196520] [ENSMUST00000200045]
Predicted Effect probably benign
Transcript: ENSMUST00000050011
AA Change: K186E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000062528
Gene: ENSMUSG00000079362
AA Change: K186E

DomainStartEndE-ValueType
Pfam:GBP 16 279 7.6e-118 PFAM
Pfam:GBP_C 281 575 2.1e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196520
AA Change: K186E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000142518
Gene: ENSMUSG00000104713
AA Change: K186E

DomainStartEndE-ValueType
Pfam:GBP 16 279 2.8e-124 PFAM
Pfam:GBP_C 281 575 2.1e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200045
SMART Domains Protein: ENSMUSP00000142994
Gene: ENSMUSG00000104713

DomainStartEndE-ValueType
Pfam:GBP 16 62 7.4e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,943,053 D103E probably benign Het
Abcc3 A T 11: 94,375,555 S70T possibly damaging Het
Atp6v0a1 A G 11: 101,029,183 Y214C possibly damaging Het
Azi2 A G 9: 118,049,895 probably null Het
BC067074 C A 13: 113,318,378 S319R probably damaging Het
Cacnb2 T A 2: 14,986,015 V636E possibly damaging Het
Cd8a A C 6: 71,374,562 T169P probably damaging Het
Cfap44 G A 16: 44,404,132 V68I probably benign Het
Eea1 G T 10: 96,037,478 C1134F probably benign Het
Ehmt2 T G 17: 34,912,772 F1192V probably damaging Het
Emc1 T C 4: 139,365,350 F531L probably damaging Het
Eme1 G A 11: 94,650,477 T173I probably benign Het
Gli2 A T 1: 118,844,416 C520S probably damaging Het
Gpr108 A T 17: 57,236,990 N405K probably damaging Het
Hmgcl C A 4: 135,955,642 T135N probably benign Het
Hydin G A 8: 110,532,856 D2487N possibly damaging Het
Igfl3 G T 7: 18,179,800 R25L probably benign Het
Igsf10 A C 3: 59,331,933 S276A probably benign Het
Kctd1 A G 18: 14,973,988 S211P probably damaging Het
Kctd7 A T 5: 130,152,501 Q255L probably benign Het
Lrig1 A G 6: 94,625,063 Y270H probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A G 16: 49,153,111 N1248S possibly damaging Het
Nod1 A G 6: 54,944,109 F408S probably benign Het
Nrp1 T C 8: 128,493,057 F652S probably damaging Het
Olfr1338 G A 4: 118,754,307 T79I probably damaging Het
Olfr487 A T 7: 108,211,918 F204I probably benign Het
Olfr574 A T 7: 102,948,768 H91L possibly damaging Het
Olfr821 T C 10: 130,034,532 M302T probably benign Het
Opa1 G T 16: 29,620,868 R792L probably benign Het
Pcdha6 G T 18: 36,968,343 L196F probably damaging Het
Pdia2 A T 17: 26,196,970 Y347* probably null Het
Pdpr G T 8: 111,124,613 probably null Het
Pigt T A 2: 164,507,331 L518Q probably damaging Het
Ppfibp2 A C 7: 107,737,981 D591A possibly damaging Het
Prrg2 G A 7: 45,059,989 T97M possibly damaging Het
Qars A G 9: 108,513,183 T428A probably damaging Het
Rai1 T C 11: 60,185,715 F202L probably damaging Het
Rars A T 11: 35,808,486 M660K probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a6 A C 11: 109,455,040 F382V probably damaging Het
Slc30a7 T C 3: 115,954,153 T330A probably damaging Het
Smc1b A T 15: 85,067,759 L1157Q probably damaging Het
Snx4 G T 16: 33,251,470 A4S possibly damaging Het
Sv2b A C 7: 75,125,767 probably null Het
Syt9 A T 7: 107,425,286 I129L probably damaging Het
Ttbk2 T C 2: 120,773,353 E198G probably damaging Het
Ubr3 A T 2: 69,944,300 D488V possibly damaging Het
Ush2a T A 1: 188,797,871 C3286S probably damaging Het
Vill A G 9: 119,065,882 D56G possibly damaging Het
Vmn1r41 A T 6: 89,747,370 I298F probably damaging Het
Vmn2r2 A T 3: 64,117,267 V631D probably damaging Het
Vmn2r32 A G 7: 7,472,574 S437P possibly damaging Het
Vmn2r53 A G 7: 12,601,142 V197A probably benign Het
Wasf1 A T 10: 40,920,369 I32F probably damaging Het
Wasf2 G T 4: 133,194,730 A387S unknown Het
Wdr92 G A 11: 17,222,309 V133M probably damaging Het
Zbtb14 G A 17: 69,387,679 C124Y probably damaging Het
Zfp462 G T 4: 55,007,671 A37S probably damaging Het
Zfp532 A G 18: 65,686,990 E882G possibly damaging Het
Other mutations in Gm43302
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0033:Gm43302 UTSW 5 105276844 missense probably benign 0.12
R0066:Gm43302 UTSW 5 105290900 missense probably damaging 1.00
R0764:Gm43302 UTSW 5 105280489 missense probably benign
R1400:Gm43302 UTSW 5 105274756 missense probably damaging 1.00
R1421:Gm43302 UTSW 5 105217349 missense probably benign
R1539:Gm43302 UTSW 5 105274769 missense probably benign 0.02
R1774:Gm43302 UTSW 5 105275794 missense probably benign 0.01
R1842:Gm43302 UTSW 5 105277736 missense probably benign 0.01
R2011:Gm43302 UTSW 5 105290980 missense probably damaging 1.00
R2131:Gm43302 UTSW 5 105274744 missense probably damaging 0.99
R2174:Gm43302 UTSW 5 105274350 missense probably benign 0.12
R3687:Gm43302 UTSW 5 105280266 missense probably damaging 1.00
R5322:Gm43302 UTSW 5 105217481 missense probably benign 0.00
R5396:Gm43302 UTSW 5 105280089 nonsense probably null
R5668:Gm43302 UTSW 5 105275812 missense probably benign
R5723:Gm43302 UTSW 5 105217486 missense possibly damaging 0.89
R6073:Gm43302 UTSW 5 105290959 missense probably damaging 0.96
R6159:Gm43302 UTSW 5 105289028 missense probably benign 0.11
R6225:Gm43302 UTSW 5 105277739 nonsense probably null
R6483:Gm43302 UTSW 5 105275860 missense probably benign 0.01
R6537:Gm43302 UTSW 5 105290995 missense possibly damaging 0.94
R6678:Gm43302 UTSW 5 105290954 missense probably benign 0.14
R7163:Gm43302 UTSW 5 105293627 splice site probably null
R7790:Gm43302 UTSW 5 105277825 missense probably benign 0.03
R7893:Gm43302 UTSW 5 105289025 nonsense probably null
R8047:Gm43302 UTSW 5 105274757 missense possibly damaging 0.74
R8350:Gm43302 UTSW 5 105274707 critical splice donor site probably null
RF014:Gm43302 UTSW 5 105274757 missense possibly damaging 0.94
Z1177:Gm43302 UTSW 5 105276796 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACCTAGCATCACTTCTGCAG -3'
(R):5'- TGGGGCAAAGCAGTGTTTAG -3'

Sequencing Primer
(F):5'- TGCAGAACTCCATCCCATTGGG -3'
(R):5'- ACCATGAGAGTGTGTGCATG -3'
Posted On2018-10-18