Incidental Mutation 'R6890:Olfr632'
ID537154
Institutional Source Beutler Lab
Gene Symbol Olfr632
Ensembl Gene ENSMUSG00000073938
Gene Nameolfactory receptor 632
SynonymsGA_x6K02T2PBJ9-6671256-6672209, MOR2-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6890 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103934347-103940579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103937859 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 160 (T160S)
Ref Sequence ENSEMBL: ENSMUSP00000149598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098189] [ENSMUST00000214711]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098189
AA Change: T160S

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095791
Gene: ENSMUSG00000073938
AA Change: T160S

DomainStartEndE-ValueType
Pfam:7tm_4 35 313 2.5e-109 PFAM
Pfam:7TM_GPCR_Srsx 39 232 7.5e-11 PFAM
Pfam:7tm_1 45 296 1.4e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214711
AA Change: T160S

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,357 Y228H probably damaging Het
Alg3 T C 16: 20,605,986 T270A possibly damaging Het
Ambp G C 4: 63,150,359 H140Q probably benign Het
Arhgef10 T C 8: 14,928,786 C18R probably benign Het
Arhgef10l A G 4: 140,544,419 F548S probably damaging Het
Cdhr1 T C 14: 37,085,645 D346G probably damaging Het
Col18a1 T A 10: 77,113,484 probably benign Het
Col1a2 T A 6: 4,539,587 L1285Q unknown Het
Cspg5 T C 9: 110,246,784 L196P probably damaging Het
Dusp10 T G 1: 184,069,196 Y387D probably damaging Het
Epb41 A T 4: 131,935,829 D681E probably damaging Het
Eps8 A G 6: 137,512,257 V381A probably damaging Het
Fam129c T A 8: 71,605,671 V540D probably damaging Het
Fbxw16 A T 9: 109,436,742 S336R probably benign Het
Gm49368 A G 7: 128,081,729 R277G probably benign Het
Gsg1 C T 6: 135,237,420 V320I probably benign Het
Iglc3 T A 16: 19,065,508 probably benign Het
Klc4 A T 17: 46,631,843 N598K probably benign Het
Malsu1 A G 6: 49,075,251 Y135C probably damaging Het
Mapkbp1 T C 2: 120,015,802 I477T probably damaging Het
Mtss1 G T 15: 58,951,659 S286R probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Npepps A T 11: 97,267,644 C98* probably null Het
Nphp3 A C 9: 104,041,954 Y1267S probably damaging Het
Npr3 A G 15: 11,883,392 V317A possibly damaging Het
Nsun6 A G 2: 15,048,977 I7T probably damaging Het
Olfr1342 A G 4: 118,689,531 V307A possibly damaging Het
Olfr1480 C T 19: 13,530,081 T180I probably damaging Het
Pcnx A G 12: 81,971,376 H1330R probably benign Het
Rad17 T C 13: 100,637,084 I201V probably benign Het
Slc26a4 G A 12: 31,549,951 T126M possibly damaging Het
Slitrk6 A T 14: 110,751,096 L393* probably null Het
Snx2 A G 18: 53,212,879 H378R probably damaging Het
Tex21 A G 12: 76,239,455 probably null Het
Trio A T 15: 27,919,288 probably benign Het
Vpreb2 T C 16: 17,980,956 I102T probably damaging Het
Zfp617 T G 8: 71,932,166 H113Q probably benign Het
Zgpat T A 2: 181,378,511 I237N probably damaging Het
Other mutations in Olfr632
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Olfr632 APN 7 103937575 missense possibly damaging 0.88
IGL01817:Olfr632 APN 7 103937823 missense probably benign 0.01
IGL02303:Olfr632 APN 7 103937563 missense possibly damaging 0.62
IGL03392:Olfr632 APN 7 103938025 missense probably benign 0.01
R0092:Olfr632 UTSW 7 103937727 missense probably damaging 1.00
R0492:Olfr632 UTSW 7 103937764 missense probably benign 0.05
R0711:Olfr632 UTSW 7 103937817 missense probably benign 0.29
R2893:Olfr632 UTSW 7 103938182 missense probably damaging 1.00
R3911:Olfr632 UTSW 7 103937409 missense possibly damaging 0.94
R4825:Olfr632 UTSW 7 103937503 missense probably benign 0.02
R6106:Olfr632 UTSW 7 103938193 missense probably benign 0.05
R6254:Olfr632 UTSW 7 103937534 missense probably benign 0.07
R6383:Olfr632 UTSW 7 103937823 missense probably benign 0.01
R6821:Olfr632 UTSW 7 103937586 missense probably benign 0.07
R7646:Olfr632 UTSW 7 103938297 missense probably damaging 0.98
R8041:Olfr632 UTSW 7 103937581 missense probably damaging 1.00
R8232:Olfr632 UTSW 7 103937773 missense possibly damaging 0.65
R8266:Olfr632 UTSW 7 103937539 missense probably damaging 0.96
R8326:Olfr632 UTSW 7 103937602 missense probably damaging 1.00
R8783:Olfr632 UTSW 7 103937544 missense possibly damaging 0.92
Z1177:Olfr632 UTSW 7 103937758 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGTCAACGCTGCCTTCTGTG -3'
(R):5'- TGAAGAGGACATCTGAACCCATG -3'

Sequencing Primer
(F):5'- TGCCCTGTGTGCTCCAG -3'
(R):5'- TCTGAACCCATGGCTAGCATGATG -3'
Posted On2018-10-18