Incidental Mutation 'R6890:9130011E15Rik'
ID537179
Institutional Source Beutler Lab
Gene Symbol 9130011E15Rik
Ensembl Gene ENSMUSG00000039901
Gene NameRIKEN cDNA 9130011E15 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6890 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location45818144-45998488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45960357 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 228 (Y228H)
Ref Sequence ENSEMBL: ENSMUSP00000048454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045396]
Predicted Effect probably damaging
Transcript: ENSMUST00000045396
AA Change: Y228H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048454
Gene: ENSMUSG00000039901
AA Change: Y228H

DomainStartEndE-ValueType
low complexity region 155 167 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
DUF1741 435 671 5.65e-139 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg3 T C 16: 20,605,986 T270A possibly damaging Het
Ambp G C 4: 63,150,359 H140Q probably benign Het
Arhgef10 T C 8: 14,928,786 C18R probably benign Het
Arhgef10l A G 4: 140,544,419 F548S probably damaging Het
Cdhr1 T C 14: 37,085,645 D346G probably damaging Het
Col18a1 T A 10: 77,113,484 probably benign Het
Col1a2 T A 6: 4,539,587 L1285Q unknown Het
Cspg5 T C 9: 110,246,784 L196P probably damaging Het
Dusp10 T G 1: 184,069,196 Y387D probably damaging Het
Epb41 A T 4: 131,935,829 D681E probably damaging Het
Eps8 A G 6: 137,512,257 V381A probably damaging Het
Fam129c T A 8: 71,605,671 V540D probably damaging Het
Fbxw16 A T 9: 109,436,742 S336R probably benign Het
Gm49368 A G 7: 128,081,729 R277G probably benign Het
Gsg1 C T 6: 135,237,420 V320I probably benign Het
Iglc3 T A 16: 19,065,508 probably benign Het
Klc4 A T 17: 46,631,843 N598K probably benign Het
Malsu1 A G 6: 49,075,251 Y135C probably damaging Het
Mapkbp1 T C 2: 120,015,802 I477T probably damaging Het
Mtss1 G T 15: 58,951,659 S286R probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Npepps A T 11: 97,267,644 C98* probably null Het
Nphp3 A C 9: 104,041,954 Y1267S probably damaging Het
Npr3 A G 15: 11,883,392 V317A possibly damaging Het
Nsun6 A G 2: 15,048,977 I7T probably damaging Het
Olfr1342 A G 4: 118,689,531 V307A possibly damaging Het
Olfr1480 C T 19: 13,530,081 T180I probably damaging Het
Olfr632 A T 7: 103,937,859 T160S possibly damaging Het
Pcnx A G 12: 81,971,376 H1330R probably benign Het
Rad17 T C 13: 100,637,084 I201V probably benign Het
Slc26a4 G A 12: 31,549,951 T126M possibly damaging Het
Slitrk6 A T 14: 110,751,096 L393* probably null Het
Snx2 A G 18: 53,212,879 H378R probably damaging Het
Tex21 A G 12: 76,239,455 probably null Het
Trio A T 15: 27,919,288 probably benign Het
Vpreb2 T C 16: 17,980,956 I102T probably damaging Het
Zfp617 T G 8: 71,932,166 H113Q probably benign Het
Zgpat T A 2: 181,378,511 I237N probably damaging Het
Other mutations in 9130011E15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:9130011E15Rik APN 19 45940488 missense probably benign 0.19
IGL00788:9130011E15Rik APN 19 45932350 critical splice donor site probably null
IGL01356:9130011E15Rik APN 19 45966303 missense possibly damaging 0.94
IGL01477:9130011E15Rik APN 19 45978604 missense probably damaging 0.99
IGL01660:9130011E15Rik APN 19 45940476 missense probably damaging 1.00
IGL02193:9130011E15Rik APN 19 45972884 missense probably benign 0.02
IGL02863:9130011E15Rik APN 19 45958411 missense probably damaging 1.00
IGL03108:9130011E15Rik APN 19 45820353 missense probably damaging 0.99
R0035:9130011E15Rik UTSW 19 45891240 missense probably damaging 1.00
R0791:9130011E15Rik UTSW 19 45933868 splice site probably null
R0792:9130011E15Rik UTSW 19 45933868 splice site probably null
R1487:9130011E15Rik UTSW 19 45940443 critical splice donor site probably null
R1843:9130011E15Rik UTSW 19 45975252 missense probably benign 0.17
R2061:9130011E15Rik UTSW 19 45978667 missense probably damaging 1.00
R2070:9130011E15Rik UTSW 19 45891285 missense probably damaging 1.00
R2072:9130011E15Rik UTSW 19 45965381 missense probably damaging 0.99
R2073:9130011E15Rik UTSW 19 45965381 missense probably damaging 0.99
R2074:9130011E15Rik UTSW 19 45965381 missense probably damaging 0.99
R2091:9130011E15Rik UTSW 19 45952680 missense probably damaging 1.00
R2263:9130011E15Rik UTSW 19 45932349 critical splice donor site probably null
R2863:9130011E15Rik UTSW 19 45885957 missense probably damaging 1.00
R3236:9130011E15Rik UTSW 19 45975283 splice site probably benign
R3796:9130011E15Rik UTSW 19 45921610 splice site probably benign
R4044:9130011E15Rik UTSW 19 45820324 missense probably damaging 1.00
R4716:9130011E15Rik UTSW 19 45960342 missense probably damaging 1.00
R4974:9130011E15Rik UTSW 19 45820287 missense probably damaging 1.00
R4983:9130011E15Rik UTSW 19 45950707 missense probably benign
R5063:9130011E15Rik UTSW 19 45885955 missense possibly damaging 0.95
R5313:9130011E15Rik UTSW 19 45818975 missense probably damaging 1.00
R5782:9130011E15Rik UTSW 19 45886027 missense probably benign 0.08
R5985:9130011E15Rik UTSW 19 45820324 missense probably damaging 1.00
R6220:9130011E15Rik UTSW 19 45846115 missense possibly damaging 0.79
R6379:9130011E15Rik UTSW 19 45921697 missense possibly damaging 0.46
R6674:9130011E15Rik UTSW 19 45974998 missense probably benign 0.06
R6842:9130011E15Rik UTSW 19 45818977 missense probably benign 0.05
R7034:9130011E15Rik UTSW 19 45965249 missense probably damaging 0.98
R7036:9130011E15Rik UTSW 19 45965249 missense probably damaging 0.98
R7305:9130011E15Rik UTSW 19 45892121 missense probably benign 0.35
R7411:9130011E15Rik UTSW 19 45965435 missense probably benign 0.00
R7762:9130011E15Rik UTSW 19 45940443 critical splice donor site probably null
R8021:9130011E15Rik UTSW 19 45956741 critical splice acceptor site probably null
R8366:9130011E15Rik UTSW 19 45932354 missense probably damaging 1.00
X0060:9130011E15Rik UTSW 19 45932393 missense possibly damaging 0.95
Z1088:9130011E15Rik UTSW 19 45818905 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCACACTATCTCACATGC -3'
(R):5'- GCGTTTGTGTGCACCAATG -3'

Sequencing Primer
(F):5'- GGTCACACTATCTCACATGCCTTAAC -3'
(R):5'- AATGCCTGGGTGAGCTCAG -3'
Posted On2018-10-18