Incidental Mutation 'R6491:Irf2bpl'
ID543457
Institutional Source Beutler Lab
Gene Symbol Irf2bpl
Ensembl Gene ENSMUSG00000034168
Gene Nameinterferon regulatory factor 2 binding protein-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R6491 (G1)
Quality Score54.0072
Status Validated
Chromosome12
Chromosomal Location86880701-86884798 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86883464 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 145 (V145A)
Ref Sequence ENSEMBL: ENSMUSP00000041070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038422]
Predicted Effect probably benign
Transcript: ENSMUST00000038422
AA Change: V145A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000041070
Gene: ENSMUSG00000034168
AA Change: V145A

DomainStartEndE-ValueType
Pfam:IRF-2BP1_2 10 61 2e-38 PFAM
low complexity region 70 78 N/A INTRINSIC
coiled coil region 84 113 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 214 234 N/A INTRINSIC
low complexity region 258 300 N/A INTRINSIC
coiled coil region 314 350 N/A INTRINSIC
low complexity region 496 519 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
low complexity region 627 646 N/A INTRINSIC
PDB:2CS3|A 684 765 7e-52 PDB
SCOP:d1fbva4 692 738 4e-6 SMART
Blast:RING 694 745 4e-24 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that may play a role in regulating female reproductive function. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,475,972 L431P probably damaging Het
Acad10 A C 5: 121,630,157 W779G probably damaging Het
Acrbp A G 6: 125,051,479 probably benign Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
Ap2a1 A T 7: 44,916,164 I93K probably damaging Het
Arnt T A 3: 95,476,143 M240K probably damaging Het
Ceacam12 A T 7: 18,069,260 K197M probably damaging Het
Cep41 T C 6: 30,656,484 N323S probably benign Het
Dst A G 1: 34,193,012 T2904A probably benign Het
Eml1 G A 12: 108,513,071 probably null Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Itga2b T C 11: 102,459,869 probably null Het
Itga8 T C 2: 12,204,776 D466G probably damaging Het
Kdm4c G T 4: 74,373,636 C830F probably damaging Het
Mrps27 T C 13: 99,363,030 S73P probably damaging Het
Mtdh T G 15: 34,116,327 N17K probably damaging Het
Muc3a A G 5: 137,212,128 S9P probably benign Het
Olfr910 A G 9: 38,647,455 L23P probably damaging Het
Oxgr1 T A 14: 120,022,007 I263F probably benign Het
Phc1 A G 6: 122,334,964 Het
Ppp2r5d A G 17: 46,685,583 F388S probably damaging Het
Pxmp4 A G 2: 154,592,163 probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 A G 4: 100,409,912 N270S possibly damaging Het
Slc7a14 T C 3: 31,223,944 Y504C probably damaging Het
Snx9 A G 17: 5,920,162 D391G probably benign Het
St18 T A 1: 6,827,985 Y670* probably null Het
Tjp1 A T 7: 65,337,117 F207I possibly damaging Het
Trappc3 A G 4: 126,275,229 I171V probably benign Het
Ugt2b5 A T 5: 87,125,469 L446* probably null Het
Vmn2r105 A T 17: 20,227,730 Y277* probably null Het
Vmn2r11 A T 5: 109,048,934 N557K possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp938 A G 10: 82,227,529 *65Q probably null Het
Other mutations in Irf2bpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03343:Irf2bpl APN 12 86882939 missense possibly damaging 0.72
twig UTSW 12 86883464 missense probably benign 0.01
PIT1430001:Irf2bpl UTSW 12 86883455 missense possibly damaging 0.91
R0218:Irf2bpl UTSW 12 86882624 missense probably benign 0.02
R0371:Irf2bpl UTSW 12 86881643 nonsense probably null
R0426:Irf2bpl UTSW 12 86883096 missense probably benign 0.06
R1351:Irf2bpl UTSW 12 86882624 missense probably benign 0.02
R2881:Irf2bpl UTSW 12 86882777 missense probably damaging 0.98
R3610:Irf2bpl UTSW 12 86881857 missense probably benign 0.03
R4206:Irf2bpl UTSW 12 86883036 missense probably benign 0.00
R4240:Irf2bpl UTSW 12 86882917 missense possibly damaging 0.73
R4938:Irf2bpl UTSW 12 86882118 missense possibly damaging 0.73
R5451:Irf2bpl UTSW 12 86882072 missense probably benign 0.33
R6213:Irf2bpl UTSW 12 86883593 missense probably benign 0.18
R6969:Irf2bpl UTSW 12 86882694 missense possibly damaging 0.86
R7151:Irf2bpl UTSW 12 86883353 missense probably benign 0.00
R7649:Irf2bpl UTSW 12 86882798 missense possibly damaging 0.96
R7751:Irf2bpl UTSW 12 86883715 missense probably damaging 0.99
X0066:Irf2bpl UTSW 12 86881650 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AGAAGCCACCGATGTTGCTG -3'
(R):5'- TTCGTGATCGAGACAGCACG -3'

Sequencing Primer
(F):5'- CACCGATGTTGCTGCTGAG -3'
(R):5'- TCACGGTTGCTTCCAAGACG -3'
Posted On2019-01-04