Incidental Mutation 'R6491:Zfp938'
ID522883
Institutional Source Beutler Lab
Gene Symbol Zfp938
Ensembl Gene ENSMUSG00000062931
Gene Namezinc finger protein 938
SynonymsB230315N10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6491 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location82224850-82241280 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 82227529 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 65 (*65Q)
Ref Sequence ENSEMBL: ENSMUSP00000121613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041264] [ENSMUST00000041264] [ENSMUST00000156218]
Predicted Effect probably null
Transcript: ENSMUST00000041264
SMART Domains Protein: ENSMUSP00000047110
Gene: ENSMUSG00000062931

DomainStartEndE-ValueType
KRAB 4 64 5.28e-14 SMART
ZnF_C2H2 161 188 2.82e1 SMART
ZnF_C2H2 267 289 1.23e0 SMART
ZnF_C2H2 295 317 2.91e-2 SMART
ZnF_C2H2 323 345 2.4e-3 SMART
ZnF_C2H2 351 373 7.26e-3 SMART
ZnF_C2H2 379 401 4.65e-1 SMART
ZnF_C2H2 407 429 1.47e-3 SMART
ZnF_C2H2 435 457 5.59e-4 SMART
ZnF_C2H2 463 485 1.82e-3 SMART
ZnF_C2H2 491 513 3.63e-3 SMART
ZnF_C2H2 519 541 7.67e-2 SMART
ZnF_C2H2 547 569 2.4e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000041264
SMART Domains Protein: ENSMUSP00000047110
Gene: ENSMUSG00000062931

DomainStartEndE-ValueType
KRAB 4 64 5.28e-14 SMART
ZnF_C2H2 161 188 2.82e1 SMART
ZnF_C2H2 267 289 1.23e0 SMART
ZnF_C2H2 295 317 2.91e-2 SMART
ZnF_C2H2 323 345 2.4e-3 SMART
ZnF_C2H2 351 373 7.26e-3 SMART
ZnF_C2H2 379 401 4.65e-1 SMART
ZnF_C2H2 407 429 1.47e-3 SMART
ZnF_C2H2 435 457 5.59e-4 SMART
ZnF_C2H2 463 485 1.82e-3 SMART
ZnF_C2H2 491 513 3.63e-3 SMART
ZnF_C2H2 519 541 7.67e-2 SMART
ZnF_C2H2 547 569 2.4e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000156218
AA Change: *65Q
SMART Domains Protein: ENSMUSP00000121613
Gene: ENSMUSG00000062931
AA Change: *65Q

DomainStartEndE-ValueType
KRAB 4 64 5.28e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,475,972 L431P probably damaging Het
Acad10 A C 5: 121,630,157 W779G probably damaging Het
Acrbp A G 6: 125,051,479 probably benign Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
Ap2a1 A T 7: 44,916,164 I93K probably damaging Het
Arnt T A 3: 95,476,143 M240K probably damaging Het
Ceacam12 A T 7: 18,069,260 K197M probably damaging Het
Cep41 T C 6: 30,656,484 N323S probably benign Het
Dst A G 1: 34,193,012 T2904A probably benign Het
Eml1 G A 12: 108,513,071 probably null Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Irf2bpl A G 12: 86,883,464 V145A probably benign Het
Itga2b T C 11: 102,459,869 probably null Het
Itga8 T C 2: 12,204,776 D466G probably damaging Het
Kdm4c G T 4: 74,373,636 C830F probably damaging Het
Mrps27 T C 13: 99,363,030 S73P probably damaging Het
Mtdh T G 15: 34,116,327 N17K probably damaging Het
Muc3a A G 5: 137,212,128 S9P probably benign Het
Olfr910 A G 9: 38,647,455 L23P probably damaging Het
Oxgr1 T A 14: 120,022,007 I263F probably benign Het
Phc1 A G 6: 122,334,964 Het
Ppp2r5d A G 17: 46,685,583 F388S probably damaging Het
Pxmp4 A G 2: 154,592,163 probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 A G 4: 100,409,912 N270S possibly damaging Het
Slc7a14 T C 3: 31,223,944 Y504C probably damaging Het
Snx9 A G 17: 5,920,162 D391G probably benign Het
St18 T A 1: 6,827,985 Y670* probably null Het
Tjp1 A T 7: 65,337,117 F207I possibly damaging Het
Trappc3 A G 4: 126,275,229 I171V probably benign Het
Ugt2b5 A T 5: 87,125,469 L446* probably null Het
Vmn2r105 A T 17: 20,227,730 Y277* probably null Het
Vmn2r11 A T 5: 109,048,934 N557K possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Other mutations in Zfp938
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Zfp938 APN 10 82227521 utr 3 prime probably benign
IGL00743:Zfp938 APN 10 82226483 missense probably benign
IGL01764:Zfp938 APN 10 82227790 splice site probably benign
IGL01814:Zfp938 APN 10 82226218 missense probably benign
IGL02244:Zfp938 APN 10 82226072 missense possibly damaging 0.86
IGL02865:Zfp938 APN 10 82226192 missense probably benign 0.33
R0372:Zfp938 UTSW 10 82227828 missense probably damaging 1.00
R0666:Zfp938 UTSW 10 82225772 missense probably damaging 1.00
R0964:Zfp938 UTSW 10 82225419 missense probably benign 0.00
R1453:Zfp938 UTSW 10 82227798 critical splice donor site probably null
R1672:Zfp938 UTSW 10 82225148 missense probably benign
R1929:Zfp938 UTSW 10 82225547 missense probably damaging 1.00
R1959:Zfp938 UTSW 10 82225631 missense probably damaging 1.00
R2127:Zfp938 UTSW 10 82226042 missense probably benign
R2271:Zfp938 UTSW 10 82225547 missense probably damaging 1.00
R2900:Zfp938 UTSW 10 82225506 missense possibly damaging 0.92
R4502:Zfp938 UTSW 10 82226271 missense possibly damaging 0.73
R4503:Zfp938 UTSW 10 82226271 missense possibly damaging 0.73
R4886:Zfp938 UTSW 10 82226123 missense probably benign 0.33
R4934:Zfp938 UTSW 10 82226178 missense possibly damaging 0.86
R5174:Zfp938 UTSW 10 82226004 missense possibly damaging 0.53
R5410:Zfp938 UTSW 10 82225258 missense possibly damaging 0.89
R6284:Zfp938 UTSW 10 82227566 missense possibly damaging 0.73
R6575:Zfp938 UTSW 10 82225326 nonsense probably null
R6649:Zfp938 UTSW 10 82225398 missense probably damaging 0.99
X0066:Zfp938 UTSW 10 82226097 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CCATCTCTGGGCTGGTAGTCT -3'
(R):5'- CAAACCTTTCTTAGAAATGAGTGCTC -3'

Sequencing Primer
(F):5'- ACTTCCTTTGGTGATGAACAGC -3'
(R):5'- CTTTCTTAGAAATGAGTGCTCTTCTG -3'
Posted On2018-06-06