Incidental Mutation 'R7031:Dhx15'
ID546315
Institutional Source Beutler Lab
Gene Symbol Dhx15
Ensembl Gene ENSMUSG00000029169
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 15
SynonymsDdx15, HRH2, DBP1, mDEAH9
MMRRC Submission
Accession Numbers

Genbank: NM_001042620, NM_007839; MGI: 1099786

Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R7031 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location52150203-52190514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52184589 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 129 (D129G)
Ref Sequence ENSEMBL: ENSMUSP00000143381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031061] [ENSMUST00000195922] [ENSMUST00000199321] [ENSMUST00000200186]
Predicted Effect probably benign
Transcript: ENSMUST00000031061
AA Change: D129G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000031061
Gene: ENSMUSG00000029169
AA Change: D129G

DomainStartEndE-ValueType
low complexity region 23 60 N/A INTRINSIC
low complexity region 79 110 N/A INTRINSIC
DEXDc 135 322 4.11e-32 SMART
AAA 152 326 1.07e-2 SMART
HELICc 363 477 1.06e-16 SMART
HA2 538 628 2.76e-31 SMART
Pfam:OB_NTP_bind 662 765 3.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195922
SMART Domains Protein: ENSMUSP00000143658
Gene: ENSMUSG00000029169

DomainStartEndE-ValueType
SCOP:d1jpna2 20 149 7e-17 SMART
Blast:AAA 24 186 4e-68 BLAST
PDB:3KX2|A 25 186 4e-65 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000199321
AA Change: D129G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000143069
Gene: ENSMUSG00000029169
AA Change: D129G

DomainStartEndE-ValueType
low complexity region 23 60 N/A INTRINSIC
low complexity region 79 110 N/A INTRINSIC
DEXDc 135 322 4.11e-32 SMART
AAA 152 326 1.07e-2 SMART
HELICc 363 477 1.06e-16 SMART
HA2 538 628 2.76e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200186
AA Change: D129G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000143381
Gene: ENSMUSG00000029169
AA Change: D129G

DomainStartEndE-ValueType
low complexity region 23 60 N/A INTRINSIC
low complexity region 79 110 N/A INTRINSIC
DEXDc 135 322 1.7e-34 SMART
AAA 152 326 1.7e-4 SMART
HELICc 363 477 4.3e-19 SMART
HA2 538 608 4.6e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative ATP-dependent RNA helicase implicated in pre-mRNA splicing. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(24) : Gene trapped(24)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,968,103 I128V probably benign Het
4930432K21Rik C A 8: 84,166,684 P160Q possibly damaging Het
4931414P19Rik T C 14: 54,595,601 N39S probably benign Het
Abca13 C T 11: 9,621,892 R4818C probably damaging Het
Acadsb A G 7: 131,443,637 I433V probably benign Het
Acsl3 T A 1: 78,688,283 I142N probably benign Het
Api5 G A 2: 94,425,616 T242M probably benign Het
Ccdc88c T C 12: 100,945,064 E37G probably damaging Het
Cntnap4 C A 8: 112,858,242 Q1104K probably benign Het
Cry1 A G 10: 85,148,662 S183P probably benign Het
Cuzd1 A T 7: 131,308,851 F572I probably benign Het
Dcbld1 A T 10: 52,290,889 D104V probably damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Drd3 T A 16: 43,762,498 V86E probably damaging Het
Ebf1 A G 11: 44,621,968 T135A possibly damaging Het
Epha5 T C 5: 84,142,300 I428V probably benign Het
Epx T A 11: 87,875,523 probably benign Het
Fam83d T A 2: 158,785,307 N305K probably benign Het
Gchfr T A 2: 119,169,755 V39D probably benign Het
Ggnbp2 A G 11: 84,860,641 L111P probably damaging Het
Gnal G A 18: 67,222,588 G340D probably damaging Het
Gpat2 A G 2: 127,435,475 E745G probably damaging Het
Gpbp1l1 C T 4: 116,592,848 R438C probably damaging Het
Hmgxb4 C T 8: 75,029,572 Q171* probably null Het
Igkv4-91 G T 6: 68,768,558 R119S possibly damaging Het
Ing2 T C 8: 47,668,823 D230G probably benign Het
Itfg2 A G 6: 128,416,054 V82A probably damaging Het
Klhl22 T C 16: 17,777,026 S340P probably damaging Het
Lipm A T 19: 34,116,471 M263L probably benign Het
Ly96 A T 1: 16,688,563 E19V possibly damaging Het
Mark1 C T 1: 184,912,632 E376K possibly damaging Het
Mlip T A 9: 77,138,553 M375L probably benign Het
Mug1 A T 6: 121,838,714 N26Y probably benign Het
Olfr1032 C T 2: 86,008,595 A273V probably benign Het
Olfr1368 C T 13: 21,143,000 S19N probably benign Het
Olfr543 T A 7: 102,477,850 T7S probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rb1cc1 T C 1: 6,238,466 probably null Het
Rgs4 T C 1: 169,743,767 T178A probably benign Het
Sel1l2 T A 2: 140,340,123 K31N possibly damaging Het
Serpinf1 T C 11: 75,410,196 R398G probably damaging Het
Sgo2b C T 8: 63,940,044 E120K possibly damaging Het
Stard9 T C 2: 120,700,450 F2396S possibly damaging Het
Tcrg-V6 G A 13: 19,190,440 E25K probably benign Het
Trpc3 A C 3: 36,621,310 I893S probably benign Het
Trpc4ap C A 2: 155,692,215 R31L unknown Het
Vat1l A G 8: 114,271,432 R239G possibly damaging Het
Vmn1r56 T A 7: 5,196,262 R119* probably null Het
Vmn2r111 T C 17: 22,571,245 Y260C probably damaging Het
Zfp664 A G 5: 124,886,006 T155A probably benign Het
Other mutations in Dhx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dhx15 APN 5 52166775 missense probably damaging 1.00
IGL00392:Dhx15 APN 5 52157582 splice site probably benign
IGL00484:Dhx15 APN 5 52166812 missense probably benign
IGL00691:Dhx15 APN 5 52170093 missense probably damaging 1.00
IGL01014:Dhx15 APN 5 52151924 missense probably damaging 1.00
IGL02808:Dhx15 APN 5 52161699 missense possibly damaging 0.95
IGL03408:Dhx15 APN 5 52160312 missense probably damaging 1.00
3-1:Dhx15 UTSW 5 52166697 splice site probably benign
PIT4449001:Dhx15 UTSW 5 52160958 missense probably damaging 0.98
R0021:Dhx15 UTSW 5 52157488 missense probably damaging 0.98
R0133:Dhx15 UTSW 5 52154072 missense possibly damaging 0.61
R0281:Dhx15 UTSW 5 52150746 missense probably benign 0.10
R0566:Dhx15 UTSW 5 52171425 missense probably damaging 1.00
R1827:Dhx15 UTSW 5 52170080 nonsense probably null
R1864:Dhx15 UTSW 5 52184701 missense possibly damaging 0.53
R2106:Dhx15 UTSW 5 52170086 missense probably benign 0.00
R2931:Dhx15 UTSW 5 52166732 missense probably benign 0.01
R2932:Dhx15 UTSW 5 52166732 missense probably benign 0.01
R3762:Dhx15 UTSW 5 52166732 missense probably benign 0.01
R3764:Dhx15 UTSW 5 52166732 missense probably benign 0.01
R3948:Dhx15 UTSW 5 52161580 splice site probably benign
R4452:Dhx15 UTSW 5 52166732 missense probably benign 0.01
R5068:Dhx15 UTSW 5 52170067 missense possibly damaging 0.59
R7431:Dhx15 UTSW 5 52162611 missense probably damaging 1.00
R8677:Dhx15 UTSW 5 52184544 missense probably benign
R8726:Dhx15 UTSW 5 52154226 missense probably benign 0.01
X0017:Dhx15 UTSW 5 52157490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGGTACTCTACAAGACAACTGG -3'
(R):5'- TGGATTGCCACCTTTAAAAGC -3'

Sequencing Primer
(F):5'- GTACTCTACAAGACAACTGGAAATG -3'
(R):5'- GGATTGCCACCTTTAAAAGCTTCTC -3'
Posted On2019-05-13