Incidental Mutation 'R7031:Drd3'
ID546347
Institutional Source Beutler Lab
Gene Symbol Drd3
Ensembl Gene ENSMUSG00000022705
Gene Namedopamine receptor D3
SynonymsD3 receptor, D3R
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R7031 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location43754026-43822932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43762498 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 86 (V86E)
Ref Sequence ENSEMBL: ENSMUSP00000023390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023390] [ENSMUST00000229953]
Predicted Effect probably damaging
Transcript: ENSMUST00000023390
AA Change: V86E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023390
Gene: ENSMUSG00000022705
AA Change: V86E

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 40 234 4.5e-9 PFAM
Pfam:7tm_1 46 429 5.9e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229953
AA Change: V118E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D3 subtype of the five (D1-D5) dopamine receptors. The activity of the D3 subtype receptor is mediated by G proteins which inhibit adenylyl cyclase. This receptor is localized to the limbic areas of the brain, which are associated with cognitive, emotional, and endocrine functions. Genetic variation in this gene may be associated with susceptibility to hereditary essential tremor 1. Alternative splicing of this gene results in transcript variants encoding different isoforms, although some variants may be subject to nonsense-mediated decay (NMD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show exploratory hyperactivity and increased locomotion and rearing behavior, with heterozygous mice displaying similar, but less pronounced, behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,968,103 I128V probably benign Het
4930432K21Rik C A 8: 84,166,684 P160Q possibly damaging Het
4931414P19Rik T C 14: 54,595,601 N39S probably benign Het
Abca13 C T 11: 9,621,892 R4818C probably damaging Het
Acadsb A G 7: 131,443,637 I433V probably benign Het
Acsl3 T A 1: 78,688,283 I142N probably benign Het
Api5 G A 2: 94,425,616 T242M probably benign Het
Ccdc88c T C 12: 100,945,064 E37G probably damaging Het
Cntnap4 C A 8: 112,858,242 Q1104K probably benign Het
Cry1 A G 10: 85,148,662 S183P probably benign Het
Cuzd1 A T 7: 131,308,851 F572I probably benign Het
Dcbld1 A T 10: 52,290,889 D104V probably damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dhx15 T C 5: 52,184,589 D129G probably benign Het
Ebf1 A G 11: 44,621,968 T135A possibly damaging Het
Epha5 T C 5: 84,142,300 I428V probably benign Het
Epx T A 11: 87,875,523 probably benign Het
Fam83d T A 2: 158,785,307 N305K probably benign Het
Gchfr T A 2: 119,169,755 V39D probably benign Het
Ggnbp2 A G 11: 84,860,641 L111P probably damaging Het
Gnal G A 18: 67,222,588 G340D probably damaging Het
Gpat2 A G 2: 127,435,475 E745G probably damaging Het
Gpbp1l1 C T 4: 116,592,848 R438C probably damaging Het
Hmgxb4 C T 8: 75,029,572 Q171* probably null Het
Igkv4-91 G T 6: 68,768,558 R119S possibly damaging Het
Ing2 T C 8: 47,668,823 D230G probably benign Het
Itfg2 A G 6: 128,416,054 V82A probably damaging Het
Klhl22 T C 16: 17,777,026 S340P probably damaging Het
Lipm A T 19: 34,116,471 M263L probably benign Het
Ly96 A T 1: 16,688,563 E19V possibly damaging Het
Mark1 C T 1: 184,912,632 E376K possibly damaging Het
Mlip T A 9: 77,138,553 M375L probably benign Het
Mug1 A T 6: 121,838,714 N26Y probably benign Het
Olfr1032 C T 2: 86,008,595 A273V probably benign Het
Olfr1368 C T 13: 21,143,000 S19N probably benign Het
Olfr543 T A 7: 102,477,850 T7S probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rb1cc1 T C 1: 6,238,466 probably null Het
Rgs4 T C 1: 169,743,767 T178A probably benign Het
Sel1l2 T A 2: 140,340,123 K31N possibly damaging Het
Serpinf1 T C 11: 75,410,196 R398G probably damaging Het
Sgo2b C T 8: 63,940,044 E120K possibly damaging Het
Stard9 T C 2: 120,700,450 F2396S possibly damaging Het
Tcrg-V6 G A 13: 19,190,440 E25K probably benign Het
Trpc3 A C 3: 36,621,310 I893S probably benign Het
Trpc4ap C A 2: 155,692,215 R31L unknown Het
Vat1l A G 8: 114,271,432 R239G possibly damaging Het
Vmn1r56 T A 7: 5,196,262 R119* probably null Het
Vmn2r111 T C 17: 22,571,245 Y260C probably damaging Het
Zfp664 A G 5: 124,886,006 T155A probably benign Het
Other mutations in Drd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Drd3 APN 16 43762321 missense probably benign 0.01
IGL01715:Drd3 APN 16 43821268 missense probably damaging 0.98
IGL01944:Drd3 APN 16 43818308 missense probably benign 0.16
IGL02212:Drd3 APN 16 43762312 missense probably benign 0.21
IGL02666:Drd3 APN 16 43816956 splice site probably benign
R0529:Drd3 UTSW 16 43822714 missense probably damaging 1.00
R1102:Drd3 UTSW 16 43762483 missense probably damaging 1.00
R1310:Drd3 UTSW 16 43821529 missense probably damaging 0.96
R1548:Drd3 UTSW 16 43821341 missense probably benign 0.01
R3124:Drd3 UTSW 16 43822792 missense probably damaging 1.00
R3753:Drd3 UTSW 16 43817103 missense probably damaging 1.00
R4363:Drd3 UTSW 16 43762359 missense probably damaging 1.00
R4724:Drd3 UTSW 16 43822801 nonsense probably null
R4725:Drd3 UTSW 16 43822801 nonsense probably null
R4726:Drd3 UTSW 16 43822801 nonsense probably null
R5016:Drd3 UTSW 16 43762246 missense possibly damaging 0.88
R5850:Drd3 UTSW 16 43818332 missense probably benign 0.00
R6052:Drd3 UTSW 16 43821283 missense probably benign 0.01
R6377:Drd3 UTSW 16 43821307 nonsense probably null
R6888:Drd3 UTSW 16 43817139 missense probably benign 0.22
R6928:Drd3 UTSW 16 43821320 missense probably benign 0.16
R7089:Drd3 UTSW 16 43807378 missense probably damaging 1.00
R7447:Drd3 UTSW 16 43817063 nonsense probably null
R7567:Drd3 UTSW 16 43822684 missense probably benign 0.00
R7575:Drd3 UTSW 16 43817133 missense probably benign 0.11
R7772:Drd3 UTSW 16 43762395 missense probably benign 0.05
R8694:Drd3 UTSW 16 43822712 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACCTCTGAGCCAGATAAG -3'
(R):5'- AGGCCTCTGGTTCTCATGAG -3'

Sequencing Primer
(F):5'- GGCAGAAAACTCCACTGGTGTC -3'
(R):5'- GAGCTTCCCTCAAGTGTCAG -3'
Posted On2019-05-13