Incidental Mutation 'R7031:Sel1l2'
ID546310
Institutional Source Beutler Lab
Gene Symbol Sel1l2
Ensembl Gene ENSMUSG00000074764
Gene Namesel-1 suppressor of lin-12-like 2 (C. elegans)
SynonymsLOC228684
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.539) question?
Stock #R7031 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location140229855-140389706 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140340123 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 31 (K31N)
Ref Sequence ENSEMBL: ENSMUSP00000113800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120133] [ENSMUST00000122367]
Predicted Effect possibly damaging
Transcript: ENSMUST00000120133
AA Change: K31N

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112724
Gene: ENSMUSG00000074764
AA Change: K31N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 70 83 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122367
AA Change: K31N

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113800
Gene: ENSMUSG00000074764
AA Change: K31N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 70 83 N/A INTRINSIC
SEL1 107 142 1.99e2 SMART
SEL1 143 178 3.3e1 SMART
SEL1 179 214 5.7e-1 SMART
SEL1 215 250 6.3e-3 SMART
SEL1 297 333 6.59e-6 SMART
SEL1 334 370 1.32e-5 SMART
SEL1 371 406 4.55e-9 SMART
SEL1 407 442 4.02e-10 SMART
SEL1 443 478 2.72e-7 SMART
Blast:SEL1 511 550 9e-13 BLAST
SEL1 551 586 1.01e-6 SMART
SEL1 588 623 4.55e-9 SMART
transmembrane domain 661 683 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,968,103 I128V probably benign Het
4930432K21Rik C A 8: 84,166,684 P160Q possibly damaging Het
4931414P19Rik T C 14: 54,595,601 N39S probably benign Het
Abca13 C T 11: 9,621,892 R4818C probably damaging Het
Acadsb A G 7: 131,443,637 I433V probably benign Het
Acsl3 T A 1: 78,688,283 I142N probably benign Het
Api5 G A 2: 94,425,616 T242M probably benign Het
Ccdc88c T C 12: 100,945,064 E37G probably damaging Het
Cntnap4 C A 8: 112,858,242 Q1104K probably benign Het
Cry1 A G 10: 85,148,662 S183P probably benign Het
Cuzd1 A T 7: 131,308,851 F572I probably benign Het
Dcbld1 A T 10: 52,290,889 D104V probably damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dhx15 T C 5: 52,184,589 D129G probably benign Het
Drd3 T A 16: 43,762,498 V86E probably damaging Het
Ebf1 A G 11: 44,621,968 T135A possibly damaging Het
Epha5 T C 5: 84,142,300 I428V probably benign Het
Epx T A 11: 87,875,523 probably benign Het
Fam83d T A 2: 158,785,307 N305K probably benign Het
Gchfr T A 2: 119,169,755 V39D probably benign Het
Ggnbp2 A G 11: 84,860,641 L111P probably damaging Het
Gnal G A 18: 67,222,588 G340D probably damaging Het
Gpat2 A G 2: 127,435,475 E745G probably damaging Het
Gpbp1l1 C T 4: 116,592,848 R438C probably damaging Het
Hmgxb4 C T 8: 75,029,572 Q171* probably null Het
Igkv4-91 G T 6: 68,768,558 R119S possibly damaging Het
Ing2 T C 8: 47,668,823 D230G probably benign Het
Itfg2 A G 6: 128,416,054 V82A probably damaging Het
Klhl22 T C 16: 17,777,026 S340P probably damaging Het
Lipm A T 19: 34,116,471 M263L probably benign Het
Ly96 A T 1: 16,688,563 E19V possibly damaging Het
Mark1 C T 1: 184,912,632 E376K possibly damaging Het
Mlip T A 9: 77,138,553 M375L probably benign Het
Mug1 A T 6: 121,838,714 N26Y probably benign Het
Olfr1032 C T 2: 86,008,595 A273V probably benign Het
Olfr1368 C T 13: 21,143,000 S19N probably benign Het
Olfr543 T A 7: 102,477,850 T7S probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rb1cc1 T C 1: 6,238,466 probably null Het
Rgs4 T C 1: 169,743,767 T178A probably benign Het
Serpinf1 T C 11: 75,410,196 R398G probably damaging Het
Sgo2b C T 8: 63,940,044 E120K possibly damaging Het
Stard9 T C 2: 120,700,450 F2396S possibly damaging Het
Tcrg-V6 G A 13: 19,190,440 E25K probably benign Het
Trpc3 A C 3: 36,621,310 I893S probably benign Het
Trpc4ap C A 2: 155,692,215 R31L unknown Het
Vat1l A G 8: 114,271,432 R239G possibly damaging Het
Vmn1r56 T A 7: 5,196,262 R119* probably null Het
Vmn2r111 T C 17: 22,571,245 Y260C probably damaging Het
Zfp664 A G 5: 124,886,006 T155A probably benign Het
Other mutations in Sel1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Sel1l2 APN 2 140243944 missense possibly damaging 0.95
IGL01782:Sel1l2 APN 2 140243935 missense probably damaging 1.00
IGL02238:Sel1l2 APN 2 140247939 missense probably damaging 1.00
IGL02506:Sel1l2 APN 2 140275460 missense possibly damaging 0.89
IGL02539:Sel1l2 APN 2 140230858 missense probably damaging 1.00
IGL02999:Sel1l2 APN 2 140230804 missense probably damaging 1.00
IGL03388:Sel1l2 APN 2 140263364 splice site probably benign
IGL02988:Sel1l2 UTSW 2 140248588 missense probably damaging 1.00
R0386:Sel1l2 UTSW 2 140275441 missense probably benign 0.11
R0426:Sel1l2 UTSW 2 140240912 nonsense probably null
R0549:Sel1l2 UTSW 2 140265882 missense probably damaging 0.99
R1404:Sel1l2 UTSW 2 140230059 splice site probably benign
R1502:Sel1l2 UTSW 2 140389595 missense probably damaging 0.99
R1746:Sel1l2 UTSW 2 140285237 missense probably damaging 0.98
R2187:Sel1l2 UTSW 2 140230873 missense probably damaging 1.00
R2233:Sel1l2 UTSW 2 140244165 missense probably damaging 1.00
R2235:Sel1l2 UTSW 2 140244165 missense probably damaging 1.00
R3402:Sel1l2 UTSW 2 140241038 missense probably damaging 1.00
R4717:Sel1l2 UTSW 2 140230023 missense possibly damaging 0.89
R4724:Sel1l2 UTSW 2 140240927 missense probably damaging 0.99
R4840:Sel1l2 UTSW 2 140263470 missense probably benign 0.00
R4948:Sel1l2 UTSW 2 140244166 missense probably damaging 1.00
R6008:Sel1l2 UTSW 2 140244105 missense probably damaging 1.00
R6058:Sel1l2 UTSW 2 140240969 missense possibly damaging 0.94
R6389:Sel1l2 UTSW 2 140245354 missense probably damaging 1.00
R7056:Sel1l2 UTSW 2 140245414 missense probably benign 0.13
R7074:Sel1l2 UTSW 2 140263442 missense probably damaging 1.00
R7213:Sel1l2 UTSW 2 140244135 missense probably damaging 1.00
R7348:Sel1l2 UTSW 2 140265724 missense probably benign
R8030:Sel1l2 UTSW 2 140241018 missense probably damaging 0.97
R8100:Sel1l2 UTSW 2 140275409 missense probably damaging 1.00
R8165:Sel1l2 UTSW 2 140262706 missense probably damaging 1.00
R8201:Sel1l2 UTSW 2 140266392 missense probably damaging 1.00
R8343:Sel1l2 UTSW 2 140230833 missense probably benign 0.03
X0019:Sel1l2 UTSW 2 140248615 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAAGGTGCCAGAGGACAC -3'
(R):5'- TCACTGTAGGGCTTACTTTAATACC -3'

Sequencing Primer
(F):5'- AGCCCAGGGAACAGTCTTCTC -3'
(R):5'- GCAAGCTCTAACTTTCTGAA -3'
Posted On2019-05-13