Incidental Mutation 'R7031:Itfg2'
ID546320
Institutional Source Beutler Lab
Gene Symbol Itfg2
Ensembl Gene ENSMUSG00000001518
Gene Nameintegrin alpha FG-GAP repeat containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7031 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location128409444-128424931 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128416054 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 82 (V82A)
Ref Sequence ENSEMBL: ENSMUSP00000001559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001559] [ENSMUST00000142615] [ENSMUST00000203026] [ENSMUST00000203374] [ENSMUST00000203853] [ENSMUST00000204836]
Predicted Effect probably damaging
Transcript: ENSMUST00000001559
AA Change: V82A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000001559
Gene: ENSMUSG00000001518
AA Change: V82A

DomainStartEndE-ValueType
Pfam:Itfg2 49 382 1e-158 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142615
AA Change: V82A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145111
Gene: ENSMUSG00000001518
AA Change: V82A

DomainStartEndE-ValueType
Pfam:Itfg2 49 358 1e-139 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203026
AA Change: V82A

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145388
Gene: ENSMUSG00000001518
AA Change: V82A

DomainStartEndE-ValueType
Pfam:Itfg2 49 130 3.9e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203374
AA Change: V50A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145323
Gene: ENSMUSG00000001518
AA Change: V50A

DomainStartEndE-ValueType
Pfam:Itfg2 21 350 1.3e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203853
SMART Domains Protein: ENSMUSP00000145282
Gene: ENSMUSG00000001518

DomainStartEndE-ValueType
Pfam:Itfg2 49 85 3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204836
SMART Domains Protein: ENSMUSP00000144750
Gene: ENSMUSG00000001520

DomainStartEndE-ValueType
Pfam:Asp_protease 28 141 8.9e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit abnormal B cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,968,103 I128V probably benign Het
4930432K21Rik C A 8: 84,166,684 P160Q possibly damaging Het
4931414P19Rik T C 14: 54,595,601 N39S probably benign Het
Abca13 C T 11: 9,621,892 R4818C probably damaging Het
Acadsb A G 7: 131,443,637 I433V probably benign Het
Acsl3 T A 1: 78,688,283 I142N probably benign Het
Api5 G A 2: 94,425,616 T242M probably benign Het
Ccdc88c T C 12: 100,945,064 E37G probably damaging Het
Cntnap4 C A 8: 112,858,242 Q1104K probably benign Het
Cry1 A G 10: 85,148,662 S183P probably benign Het
Cuzd1 A T 7: 131,308,851 F572I probably benign Het
Dcbld1 A T 10: 52,290,889 D104V probably damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dhx15 T C 5: 52,184,589 D129G probably benign Het
Drd3 T A 16: 43,762,498 V86E probably damaging Het
Ebf1 A G 11: 44,621,968 T135A possibly damaging Het
Epha5 T C 5: 84,142,300 I428V probably benign Het
Epx T A 11: 87,875,523 probably benign Het
Fam83d T A 2: 158,785,307 N305K probably benign Het
Gchfr T A 2: 119,169,755 V39D probably benign Het
Ggnbp2 A G 11: 84,860,641 L111P probably damaging Het
Gnal G A 18: 67,222,588 G340D probably damaging Het
Gpat2 A G 2: 127,435,475 E745G probably damaging Het
Gpbp1l1 C T 4: 116,592,848 R438C probably damaging Het
Hmgxb4 C T 8: 75,029,572 Q171* probably null Het
Igkv4-91 G T 6: 68,768,558 R119S possibly damaging Het
Ing2 T C 8: 47,668,823 D230G probably benign Het
Klhl22 T C 16: 17,777,026 S340P probably damaging Het
Lipm A T 19: 34,116,471 M263L probably benign Het
Ly96 A T 1: 16,688,563 E19V possibly damaging Het
Mark1 C T 1: 184,912,632 E376K possibly damaging Het
Mlip T A 9: 77,138,553 M375L probably benign Het
Mug1 A T 6: 121,838,714 N26Y probably benign Het
Olfr1032 C T 2: 86,008,595 A273V probably benign Het
Olfr1368 C T 13: 21,143,000 S19N probably benign Het
Olfr543 T A 7: 102,477,850 T7S probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rb1cc1 T C 1: 6,238,466 probably null Het
Rgs4 T C 1: 169,743,767 T178A probably benign Het
Sel1l2 T A 2: 140,340,123 K31N possibly damaging Het
Serpinf1 T C 11: 75,410,196 R398G probably damaging Het
Sgo2b C T 8: 63,940,044 E120K possibly damaging Het
Stard9 T C 2: 120,700,450 F2396S possibly damaging Het
Tcrg-V6 G A 13: 19,190,440 E25K probably benign Het
Trpc3 A C 3: 36,621,310 I893S probably benign Het
Trpc4ap C A 2: 155,692,215 R31L unknown Het
Vat1l A G 8: 114,271,432 R239G possibly damaging Het
Vmn1r56 T A 7: 5,196,262 R119* probably null Het
Vmn2r111 T C 17: 22,571,245 Y260C probably damaging Het
Zfp664 A G 5: 124,886,006 T155A probably benign Het
Other mutations in Itfg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Itfg2 APN 6 128411606 missense probably benign 0.02
IGL02111:Itfg2 APN 6 128410381 missense probably benign 0.01
IGL02337:Itfg2 APN 6 128413570 missense probably benign 0.02
IGL02611:Itfg2 APN 6 128424725 missense probably damaging 1.00
R0492:Itfg2 UTSW 6 128413523 critical splice donor site probably null
R1462:Itfg2 UTSW 6 128424728 missense probably damaging 1.00
R1462:Itfg2 UTSW 6 128424728 missense probably damaging 1.00
R2960:Itfg2 UTSW 6 128413552 missense probably benign 0.33
R3110:Itfg2 UTSW 6 128411669 missense probably damaging 1.00
R3112:Itfg2 UTSW 6 128411669 missense probably damaging 1.00
R4067:Itfg2 UTSW 6 128410450 intron probably benign
R4866:Itfg2 UTSW 6 128416316 intron probably benign
R4900:Itfg2 UTSW 6 128416316 intron probably benign
R6623:Itfg2 UTSW 6 128411657 missense probably damaging 1.00
R6979:Itfg2 UTSW 6 128411591 missense probably damaging 1.00
R7162:Itfg2 UTSW 6 128410583 missense probably damaging 0.98
R7660:Itfg2 UTSW 6 128424746 missense probably damaging 0.99
R7884:Itfg2 UTSW 6 128416381 intron probably benign
R8750:Itfg2 UTSW 6 128412792 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AACTCTCCATCTTGGCCCAG -3'
(R):5'- GGAGGTCACATGACAAGCTTTC -3'

Sequencing Primer
(F):5'- TCTGCCCAGGAACCCACTG -3'
(R):5'- CGAGATGAATGTTCTCTCTTGGTACC -3'
Posted On2019-05-13