Mutagenetix > Incidental Mutation

Incidental Mutation 'R2169:Rapgef5'

235677

Institutional Source

Beutler Lab

Gene Symbol

Rapgef5

Ensembl Gene

ENSMUSG00000041992

Gene Name

Rap guanine nucleotide exchange factor (GEF) 5

Synonyms

D030051B22Rik, mr-gef

MMRRC Submission

040172-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2169 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

117516479-117759737 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 117715395 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 234 (Y234C)

Ref Sequence

ENSEMBL: ENSMUSP00000152875 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109691] [ENSMUST00000222105] [ENSMUST00000222185]

AlphaFold

Q8C0Q9

Predicted Effect

probably benign
Transcript: ENSMUST00000109691
AA Change: Y436C

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000105313
Gene: ENSMUSG00000041992
AA Change: Y436C

Domain	Start	End	E-Value	Type
DEP	44	118	2.07e-12	SMART
RasGEFN	300	434	3.12e-34	SMART
Blast:RasGEF	441	502	7e-31	BLAST
RasGEF	574	814	1.52e-100	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000222105
AA Change: Y234C

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

probably benign
Transcript: ENSMUST00000222185
AA Change: Y202C

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223040

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RAPGEF5, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	A	G	13: 119,485,813	T606A	probably benign	Het
Adtrp	T	A	13: 41,767,429	S221C	possibly damaging	Het
Ap1g2	T	A	14: 55,099,340		probably null	Het
Arhgef5	A	T	6: 43,274,420	M702L	probably benign	Het
Axdnd1	A	G	1: 156,418,309	V34A	probably damaging	Het
Ccdc154	T	A	17: 25,170,923	V509E	probably damaging	Het
Cttnbp2	C	T	6: 18,426,097	D761N	probably benign	Het
Ddx18	A	T	1: 121,558,409		probably null	Het
Fam241b	A	T	10: 62,109,966	I4N	probably damaging	Het
Fam69a	A	T	5: 107,909,459	L411*	probably null	Het
Gm5800	T	C	14: 51,713,678	K155E	possibly damaging	Het
Hemgn	T	A	4: 46,396,417	H273L	possibly damaging	Het
Hsp90aa1	A	G	12: 110,692,734	V543A	probably damaging	Het
Hspa1l	A	G	17: 34,977,323	K113E	probably benign	Het
Hspb2	A	G	9: 50,751,715	I38T	probably damaging	Het
Htt	A	T	5: 34,877,475	E2021D	probably benign	Het
Lrpprc	C	T	17: 84,770,077	R394Q	probably benign	Het
Lrrc8b	T	C	5: 105,481,887	Y700H	probably damaging	Het
Mefv	A	G	16: 3,710,888	V593A	probably benign	Het
Mrgprh	C	T	17: 12,876,969	T32M	probably benign	Het
Mrpl18	A	G	17: 12,913,768		probably null	Het
Muc1	A	G	3: 89,231,596	E504G	probably damaging	Het
Ndufa13	G	A	8: 69,894,519	A77V	probably damaging	Het
Olfr952	A	G	9: 39,426,358	F238L	possibly damaging	Het
Pgbd5	T	A	8: 124,384,624		probably null	Het
Pgm5	T	A	19: 24,834,815	I118F	probably damaging	Het
Phyhip	T	C	14: 70,467,132	F264L	possibly damaging	Het
Polr3e	C	T	7: 120,932,137	R176W	probably damaging	Het
Prkacb	C	T	3: 146,746,683		probably null	Het
Rab19	T	G	6: 39,384,041	V41G	possibly damaging	Het
Slc26a5	T	C	5: 21,813,865	T659A	probably damaging	Het
Slc6a2	G	A	8: 92,994,101	V449I	probably benign	Het
Stab2	A	G	10: 86,887,862	S1490P	probably damaging	Het
Tln1	T	C	4: 43,548,005	T713A	probably damaging	Het
Tmc6	A	T	11: 117,769,106	L732Q	probably damaging	Het
Unc80	C	T	1: 66,521,581	H823Y	possibly damaging	Het
Vmn1r203	A	T	13: 22,524,735	K229*	probably null	Het
Xylt1	G	A	7: 117,667,437	G893R	probably damaging	Het
Ythdf1	A	T	2: 180,912,114	S69T	probably damaging	Het
Zfp114	C	T	7: 24,181,084	T285I	probably benign	Het
Zfp458	T	C	13: 67,257,049	E439G	probably damaging	Het
Zfp65	G	A	13: 67,710,380	T55I	probably damaging	Het
Zmym1	C	T	4: 127,054,203		probably null	Het

Other mutations in Rapgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Rapgef5	APN	12	117714182	missense	probably damaging	0.99
IGL01405:Rapgef5	APN	12	117721380	missense	probably benign	0.16
IGL01611:Rapgef5	APN	12	117753419	splice site	probably benign
IGL01720:Rapgef5	APN	12	117613435	splice site	probably benign
IGL01958:Rapgef5	APN	12	117730651	missense	probably benign	0.24
IGL02093:Rapgef5	APN	12	117719132	missense	probably damaging	0.98
IGL03210:Rapgef5	APN	12	117742872	missense	probably damaging	1.00
IGL03370:Rapgef5	APN	12	117730559	missense	probably damaging	1.00
IGL03397:Rapgef5	APN	12	117748441	missense	probably damaging	1.00
R0026:Rapgef5	UTSW	12	117689161	missense	probably benign	0.11
R0026:Rapgef5	UTSW	12	117689161	missense	probably benign	0.11
R0100:Rapgef5	UTSW	12	117721299	missense	probably benign	0.05
R0173:Rapgef5	UTSW	12	117688676	missense	probably benign	0.00
R0834:Rapgef5	UTSW	12	117647121	splice site	probably benign
R1331:Rapgef5	UTSW	12	117721349	missense	probably benign	0.04
R1505:Rapgef5	UTSW	12	117688619	missense	possibly damaging	0.92
R1546:Rapgef5	UTSW	12	117647101	missense	probably benign	0.00
R1577:Rapgef5	UTSW	12	117595291	missense	probably benign	0.28
R1597:Rapgef5	UTSW	12	117658320	missense	probably damaging	1.00
R1824:Rapgef5	UTSW	12	117688684	critical splice donor site	probably null
R2065:Rapgef5	UTSW	12	117584119	nonsense	probably null
R2117:Rapgef5	UTSW	12	117714064	splice site	probably null
R2903:Rapgef5	UTSW	12	117714119	missense	probably damaging	1.00
R3983:Rapgef5	UTSW	12	117728670	missense	possibly damaging	0.49
R4004:Rapgef5	UTSW	12	117748397	missense	probably damaging	0.99
R4652:Rapgef5	UTSW	12	117714128	missense	probably damaging	0.99
R4830:Rapgef5	UTSW	12	117756074	missense	probably damaging	1.00
R5282:Rapgef5	UTSW	12	117739644	missense	probably damaging	1.00
R5348:Rapgef5	UTSW	12	117688611	missense	probably benign	0.24
R5456:Rapgef5	UTSW	12	117728646	splice site	probably null
R5502:Rapgef5	UTSW	12	117721329	missense	probably damaging	1.00
R5741:Rapgef5	UTSW	12	117756029	missense	probably damaging	0.99
R5771:Rapgef5	UTSW	12	117721326	missense	probably benign	0.45
R5905:Rapgef5	UTSW	12	117748426	missense	probably damaging	1.00
R5941:Rapgef5	UTSW	12	117728738	missense	probably damaging	1.00
R6228:Rapgef5	UTSW	12	117721663	splice site	probably null
R6233:Rapgef5	UTSW	12	117739718	critical splice donor site	probably null
R6376:Rapgef5	UTSW	12	117721253	missense	probably damaging	1.00
R6475:Rapgef5	UTSW	12	117718207	missense	probably damaging	1.00
R7063:Rapgef5	UTSW	12	117689129	missense	possibly damaging	0.91
R7410:Rapgef5	UTSW	12	117721328	missense	probably damaging	1.00
R7445:Rapgef5	UTSW	12	117755969	missense	probably benign	0.00
R7690:Rapgef5	UTSW	12	117721370	missense	possibly damaging	0.72
R7707:Rapgef5	UTSW	12	117715344	missense	probably damaging	1.00
R7815:Rapgef5	UTSW	12	117755967	missense	probably benign	0.10
R8461:Rapgef5	UTSW	12	117714109	missense	probably benign	0.00
R8475:Rapgef5	UTSW	12	117718230	missense	probably damaging	0.99
R8675:Rapgef5	UTSW	12	117584162	missense	probably damaging	1.00
R8682:Rapgef5	UTSW	12	117581812	missense	probably benign	0.06
R9018:Rapgef5	UTSW	12	117748397	missense	probably damaging	0.99
R9617:Rapgef5	UTSW	12	117658310	missense	probably benign	0.00
X0018:Rapgef5	UTSW	12	117718215	missense	probably damaging	1.00
Z1176:Rapgef5	UTSW	12	117595288	missense	probably damaging	1.00
Z1177:Rapgef5	UTSW	12	117688997	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGGCTGGAGACCACATTACTTC -3'
(R):5'- AAAGGTCTGGAGTCTGATTCG -3'

Sequencing Primer
(F):5'- AAACGTGTGTTTGACCACTGAGC -3'
(R):5'- AAAGGTCTGGAGTCTGATTCGTTTTC -3'

Posted On

2014-10-01