Incidental Mutation 'PIT4469001:Gm6205'
ID555822
Institutional Source Beutler Lab
Gene Symbol Gm6205
Ensembl Gene ENSMUSG00000092073
Gene Namepredicted gene 6205
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #PIT4469001 (G1)
Quality Score153.008
Status Not validated
Chromosome5
Chromosomal Location94648382-94686353 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94682793 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 50 (V50E)
Ref Sequence ENSEMBL: ENSMUSP00000131590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165424] [ENSMUST00000190001]
Predicted Effect probably damaging
Transcript: ENSMUST00000165424
AA Change: V50E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131590
Gene: ENSMUSG00000092073
AA Change: V50E

DomainStartEndE-ValueType
SCOP:d1a4ya_ 199 359 1e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190001
AA Change: V50E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139603
Gene: ENSMUSG00000092073
AA Change: V50E

DomainStartEndE-ValueType
SCOP:d1a4ya_ 199 359 1e-4 SMART
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 71.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030408B16Rik T C 15: 101,293,271 V6A probably benign Het
A630001G21Rik A G 1: 85,725,199 F83L probably benign Het
Acsm2 T A 7: 119,578,185 C308S possibly damaging Het
Ak3 A G 19: 29,047,757 S25P probably damaging Het
Atp13a2 T A 4: 140,994,127 V176E unknown Het
Bmper A T 9: 23,406,549 H488L probably benign Het
Cacna1c A T 6: 118,595,972 C2084S unknown Het
Ccp110 T A 7: 118,722,377 N418K probably benign Het
Ddx17 C A 15: 79,543,813 G32C probably damaging Het
Dusp16 G A 6: 134,761,152 probably benign Het
Efl1 T G 7: 82,658,165 F90V probably benign Het
Ell2 T A 13: 75,761,892 N252K probably damaging Het
Gdf6 T C 4: 9,859,569 V217A probably damaging Het
Hint1 T A 11: 54,870,070 S112T unknown Het
Hist1h1e A T 13: 23,622,379 V40E probably damaging Het
Kif5c T C 2: 49,741,348 V679A probably benign Het
Lrrn3 A T 12: 41,453,018 D433E probably benign Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Naa11 A G 5: 97,391,626 probably null Het
Pcdh18 T A 3: 49,755,069 H599L probably benign Het
Pgc A T 17: 47,728,755 K25* probably null Het
Psd4 G A 2: 24,394,294 D57N probably benign Het
Pxdn G A 12: 30,005,829 R1238Q probably benign Het
Spata32 T C 11: 103,209,827 N38S probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpr A G 1: 150,403,956 T279A probably benign Het
Unc13a C A 8: 71,658,314 E418* probably null Het
Vmn2r97 C A 17: 18,929,616 T422K probably benign Het
Zfp474 A T 18: 52,638,719 Q148L possibly damaging Het
Other mutations in Gm6205
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02676:Gm6205 APN 5 94683871 missense possibly damaging 0.64
R6809:Gm6205 UTSW 5 94683418 missense probably benign 0.10
R6816:Gm6205 UTSW 5 94683914 missense possibly damaging 0.70
R7482:Gm6205 UTSW 5 94682880 missense possibly damaging 0.87
R7583:Gm6205 UTSW 5 94682894 missense possibly damaging 0.94
R7799:Gm6205 UTSW 5 94683428 missense possibly damaging 0.94
R8307:Gm6205 UTSW 5 94683557 missense probably damaging 1.00
R8334:Gm6205 UTSW 5 94682776 missense probably benign 0.04
R8459:Gm6205 UTSW 5 94682883 missense probably damaging 0.97
R8460:Gm6205 UTSW 5 94683931 missense probably benign 0.39
Z1088:Gm6205 UTSW 5 94683833 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTAACTGCTTCCCCAGGAG -3'
(R):5'- GCATCTGATCCATTTAGTACAAAGCC -3'

Sequencing Primer
(F):5'- CAGGAGCCTTTACTGAAGACCTG -3'
(R):5'- TTTAGTACAAAGCCAATCTCCCTGG -3'
Posted On2019-06-07