Incidental Mutation 'R0576:Lipo2'
ID56249
Institutional Source Beutler Lab
Gene Symbol Lipo2
Ensembl Gene ENSMUSG00000087303
Gene Namelipase, member O2
SynonymsGm8981
MMRRC Submission 038766-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R0576 (G1)
Quality Score86
Status Validated
Chromosome19
Chromosomal Location33719670-33769142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33749424 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 71 (S71N)
Ref Sequence ENSEMBL: ENSMUSP00000118907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025694] [ENSMUST00000147153]
Predicted Effect probably benign
Transcript: ENSMUST00000025694
SMART Domains Protein: ENSMUSP00000025694
Gene: ENSMUSG00000024766

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 33 95 4.2e-24 PFAM
Pfam:Abhydrolase_1 76 213 7.3e-16 PFAM
Pfam:Abhydrolase_5 76 370 4.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147153
AA Change: S71N

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000118907
Gene: ENSMUSG00000087303
AA Change: S71N

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 33 95 4.4e-24 PFAM
Pfam:Abhydrolase_1 76 213 1.7e-15 PFAM
Pfam:Abhydrolase_5 76 370 1.5e-11 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,713,470 F839L probably benign Het
Ccdc77 T A 6: 120,331,848 L335F probably benign Het
Ccr3 T A 9: 124,029,009 F127Y probably damaging Het
Cfap43 T C 19: 47,797,140 N437S probably benign Het
Cfh A G 1: 140,136,815 V365A probably damaging Het
Copg1 T A 6: 87,897,963 V380D probably damaging Het
Cxxc1 T C 18: 74,220,185 I497T possibly damaging Het
Disp3 G A 4: 148,241,590 T1237I possibly damaging Het
Dnah7a A T 1: 53,636,087 F360L probably benign Het
Dnhd1 C T 7: 105,714,045 A3938V probably damaging Het
Eif4g1 A G 16: 20,684,068 D1000G probably damaging Het
Emsy A T 7: 98,593,776 V1052D probably damaging Het
Ep400 A G 5: 110,711,093 probably benign Het
Fa2h T C 8: 111,356,147 H146R probably damaging Het
Gad1 G A 2: 70,594,652 C430Y probably benign Het
Gm38394 A G 1: 133,657,838 F587S probably benign Het
Gtse1 T C 15: 85,869,051 S456P probably damaging Het
Gucy2g T C 19: 55,198,770 T1073A probably damaging Het
Hectd2 T G 19: 36,585,497 N3K probably benign Het
Hmcn1 A T 1: 150,650,017 C3318* probably null Het
Mynn G T 3: 30,607,068 D100Y probably damaging Het
Myo16 G A 8: 10,562,318 probably null Het
Npr2 G T 4: 43,640,947 K384N probably benign Het
Nrde2 A G 12: 100,132,233 V725A possibly damaging Het
Olfr166 A G 16: 19,487,188 M117V probably damaging Het
Olfr748 T A 14: 50,711,204 S291R probably damaging Het
Otud7a C T 7: 63,685,518 P101S possibly damaging Het
Pcdhb7 T A 18: 37,342,357 L182Q probably benign Het
Pdss1 A G 2: 22,915,413 probably null Het
Ppargc1b T A 18: 61,311,441 H233L probably damaging Het
Ppm1b A G 17: 85,013,559 probably null Het
Prdm14 A T 1: 13,125,725 S37R possibly damaging Het
Prss45 A G 9: 110,838,429 T39A probably benign Het
Qars T C 9: 108,514,962 probably benign Het
Rxfp2 T G 5: 150,038,247 H77Q probably benign Het
Scd4 A G 19: 44,341,246 M219V probably benign Het
Sec24b G T 3: 130,041,336 P71Q probably benign Het
Snd1 T G 6: 28,886,577 V861G probably benign Het
Sspo A G 6: 48,464,942 probably null Het
Tas2r129 A G 6: 132,951,534 T145A probably benign Het
Tbc1d31 T A 15: 57,969,724 I953N possibly damaging Het
Tlr4 A G 4: 66,839,495 N175S probably benign Het
Tspyl4 A G 10: 34,298,522 N337D probably damaging Het
Ttn A T 2: 76,812,201 L13330H probably damaging Het
Usp33 T A 3: 152,384,119 Y765* probably null Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Zfhx4 T C 3: 5,402,101 S2465P probably damaging Het
Other mutations in Lipo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Lipo2 APN 19 33721024 missense probably benign 0.03
IGL01780:Lipo2 APN 19 33730948 missense possibly damaging 0.82
IGL01868:Lipo2 APN 19 33730838 missense probably benign 0.00
IGL02291:Lipo2 APN 19 33745792 missense possibly damaging 0.80
IGL02350:Lipo2 APN 19 33730948 missense possibly damaging 0.82
IGL02357:Lipo2 APN 19 33730948 missense possibly damaging 0.82
IGL02560:Lipo2 APN 19 33730948 missense possibly damaging 0.82
IGL03354:Lipo2 APN 19 33730870 missense probably benign 0.09
R0183:Lipo2 UTSW 19 33749551 splice site probably null
R0529:Lipo2 UTSW 19 33746935 missense probably benign 0.05
R0579:Lipo2 UTSW 19 33746898 missense probably damaging 0.99
R0594:Lipo2 UTSW 19 33746902 missense possibly damaging 0.95
R0621:Lipo2 UTSW 19 33730939 missense probably damaging 1.00
R1019:Lipo2 UTSW 19 33730857 nonsense probably null
R2190:Lipo2 UTSW 19 33748569 missense probably damaging 1.00
R2413:Lipo2 UTSW 19 33751257 missense probably damaging 0.98
R4066:Lipo2 UTSW 19 33720859 missense probably benign 0.01
R4258:Lipo2 UTSW 19 33730928 missense possibly damaging 0.88
R4365:Lipo2 UTSW 19 33721708 missense probably damaging 1.00
R4491:Lipo2 UTSW 19 33721700 missense probably damaging 0.99
R4640:Lipo2 UTSW 19 33720837 missense probably benign 0.04
R4822:Lipo2 UTSW 19 33745751 missense probably benign 0.01
R4872:Lipo2 UTSW 19 33749514 missense probably benign 0.00
R5004:Lipo2 UTSW 19 33721676 critical splice donor site probably null
R5112:Lipo2 UTSW 19 33748465 missense probably benign 0.00
R5440:Lipo2 UTSW 19 33720858 missense probably benign 0.39
R5737:Lipo2 UTSW 19 33721696 missense probably damaging 1.00
R6209:Lipo2 UTSW 19 33749452 missense probably damaging 1.00
R6868:Lipo2 UTSW 19 33748462 missense possibly damaging 0.86
R6893:Lipo2 UTSW 19 33721007 nonsense probably null
R7176:Lipo2 UTSW 19 33745807 missense possibly damaging 0.71
R7853:Lipo2 UTSW 19 33759944 start gained probably benign
R7936:Lipo2 UTSW 19 33759944 start gained probably benign
X0052:Lipo2 UTSW 19 33720945 missense probably damaging 1.00
Z1088:Lipo2 UTSW 19 33721685 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAATGCTAGGTTCTTTTAAGCCCCAG -3'
(R):5'- TGGCTGCATCTCTTACAATCTGAACAG -3'

Sequencing Primer
(F):5'- CAGCATTAATCGTGGGCATC -3'
(R):5'- TCTCTTACAATCTGAACAGTGACCAG -3'
Posted On2013-07-11