Incidental Mutation 'R7256:Adamts5'
ID 564301
Institutional Source Beutler Lab
Gene Symbol Adamts5
Ensembl Gene ENSMUSG00000022894
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)
Synonyms 9530092O11Rik, ADAM-TS5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock # R7256 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 85856173-85901828 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85863035 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 790 (Y790H)
Ref Sequence ENSEMBL: ENSMUSP00000023611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023611]
AlphaFold Q9R001
Predicted Effect probably damaging
Transcript: ENSMUST00000023611
AA Change: Y790H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: Y790H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 182 9.1e-18 PFAM
low complexity region 226 232 N/A INTRINSIC
Pfam:Reprolysin_5 265 450 2.1e-16 PFAM
Pfam:Reprolysin_4 265 472 4.8e-14 PFAM
Pfam:Reprolysin 267 476 4.6e-26 PFAM
Pfam:Reprolysin_2 286 466 3.7e-13 PFAM
Pfam:Reprolysin_3 288 421 6.9e-17 PFAM
Blast:ACR 477 555 4e-15 BLAST
low complexity region 556 566 N/A INTRINSIC
TSP1 570 622 6.04e-13 SMART
Pfam:ADAM_spacer1 732 852 1.7e-35 PFAM
TSP1 878 926 7.12e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bend3 A C 10: 43,493,671 S7R probably benign Het
Ccdc106 A G 7: 5,060,326 T277A probably damaging Het
Ccdc162 G A 10: 41,556,001 A1832V probably damaging Het
Ccser1 A G 6: 61,311,867 E338G probably benign Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cecr2 T C 6: 120,762,529 S1406P probably benign Het
Cep290 A G 10: 100,546,498 T208A probably damaging Het
Cep85l A C 10: 53,296,255 C569W probably damaging Het
Ces5a G A 8: 93,499,526 T527I probably benign Het
Clca2 T A 3: 145,090,847 I200F probably damaging Het
Cmas G A 6: 142,770,586 D251N probably damaging Het
Ctcfl G T 2: 173,118,475 A105E probably benign Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
Dctn6 A T 8: 34,090,808 I170N probably damaging Het
Dnah2 T C 11: 69,431,094 Y3800C probably damaging Het
Dsg2 G A 18: 20,591,931 V465I possibly damaging Het
Dzip1 T C 14: 118,885,646 T646A probably benign Het
Etv4 T A 11: 101,784,325 probably null Het
Exoc3l2 T C 7: 19,484,703 V549A unknown Het
Ficd G T 5: 113,738,819 A352S probably damaging Het
Fry T G 5: 150,466,786 I179S Het
Galntl5 A G 5: 25,195,300 H109R probably benign Het
Garem1 C A 18: 21,148,754 G182W probably damaging Het
Gm10696 T C 3: 94,176,360 E48G probably benign Het
Gm13078 T A 4: 143,726,279 D93E probably benign Het
Gm5916 A T 9: 36,120,989 Y50N possibly damaging Het
Gtf2h2 A T 13: 100,479,201 F271I probably benign Het
Hivep2 G T 10: 14,129,101 S481I probably benign Het
Homez T A 14: 54,857,420 Q277L probably damaging Het
Hoxb4 C A 11: 96,319,896 probably null Het
Igll1 A G 16: 16,861,093 S118P probably damaging Het
Ikzf2 A C 1: 69,578,053 probably null Het
Kif5b A G 18: 6,225,340 V230A probably damaging Het
Ldlr T A 9: 21,745,744 V719E probably benign Het
Lsm7 G A 10: 80,853,731 R66W possibly damaging Het
Map3k13 T A 16: 21,892,238 D90E probably benign Het
Mmrn1 A G 6: 60,976,114 K460E probably damaging Het
Myh10 A C 11: 68,790,689 N1061H probably damaging Het
Nepn A G 10: 52,400,993 Q275R probably benign Het
Noc3l A T 19: 38,812,356 D227E probably benign Het
Nploc4 G T 11: 120,428,550 S61R probably benign Het
Nr4a2 T C 2: 57,112,369 Y24C probably damaging Het
Nup160 T A 2: 90,723,355 I1143N probably damaging Het
Olfr1097 A G 2: 86,890,612 S188P probably damaging Het
Olfr1234 A T 2: 89,362,494 Y312N probably benign Het
Olfr294 G T 7: 86,615,665 H327N probably benign Het
Olfr895 T A 9: 38,268,708 M57K probably damaging Het
Papola T A 12: 105,809,345 C204S probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pgap1 A T 1: 54,493,207 probably null Het
Pitrm1 A G 13: 6,556,597 H229R probably damaging Het
Plcl1 A G 1: 55,698,218 Q906R probably benign Het
Ppfia3 T C 7: 45,341,743 N1018S probably benign Het
Prkd1 A G 12: 50,388,342 V534A possibly damaging Het
Pygm A T 19: 6,385,896 I126F probably benign Het
Rag1 T C 2: 101,642,070 Y909C probably damaging Het
Rasgrf2 G A 13: 91,884,518 Q560* probably null Het
Rbp3 A T 14: 33,962,583 I1190F possibly damaging Het
Reln T C 5: 21,978,923 K1693E probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rsph3a A G 17: 7,946,170 T121A probably benign Het
Rufy3 A G 5: 88,614,947 N112S possibly damaging Het
Ryr3 G A 2: 112,672,246 Q3548* probably null Het
Sardh A T 2: 27,218,812 V637D probably benign Het
Spata16 T C 3: 26,667,867 V179A probably benign Het
Tbc1d30 G A 10: 121,288,965 T319I probably damaging Het
Tlr2 T A 3: 83,837,606 Q390L possibly damaging Het
Tmem53 C T 4: 117,252,040 probably null Het
Vmn1r113 T A 7: 20,787,445 I54N probably damaging Het
Vmn1r223 A C 13: 23,249,866 Y210S probably damaging Het
Zbbx A T 3: 75,039,898 H670Q probably benign Het
Other mutations in Adamts5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Adamts5 APN 16 85899834 missense probably damaging 1.00
IGL01070:Adamts5 APN 16 85863133 missense probably damaging 1.00
IGL01321:Adamts5 APN 16 85899475 missense probably benign 0.03
IGL01616:Adamts5 APN 16 85887814 splice site probably null
IGL02551:Adamts5 APN 16 85870038 missense possibly damaging 0.71
IGL03263:Adamts5 APN 16 85869942 missense probably damaging 0.99
IGL03295:Adamts5 APN 16 85877945 missense probably damaging 1.00
IGL03393:Adamts5 APN 16 85868195 missense probably damaging 0.99
IGL03403:Adamts5 APN 16 85863014 missense probably damaging 0.97
R0414:Adamts5 UTSW 16 85877906 missense probably damaging 1.00
R0419:Adamts5 UTSW 16 85866642 missense probably benign 0.00
R0539:Adamts5 UTSW 16 85868692 missense probably damaging 1.00
R0570:Adamts5 UTSW 16 85899247 missense probably damaging 1.00
R0574:Adamts5 UTSW 16 85899484 missense probably damaging 0.99
R0669:Adamts5 UTSW 16 85899726 missense probably benign 0.45
R1454:Adamts5 UTSW 16 85869993 missense possibly damaging 0.88
R1498:Adamts5 UTSW 16 85900102 missense possibly damaging 0.63
R1729:Adamts5 UTSW 16 85877915 nonsense probably null
R1753:Adamts5 UTSW 16 85899352 missense probably damaging 1.00
R1784:Adamts5 UTSW 16 85877915 nonsense probably null
R1906:Adamts5 UTSW 16 85868685 nonsense probably null
R1946:Adamts5 UTSW 16 85899243 missense probably damaging 1.00
R2180:Adamts5 UTSW 16 85887924 missense probably damaging 1.00
R2223:Adamts5 UTSW 16 85899306 missense probably damaging 1.00
R2366:Adamts5 UTSW 16 85862758 missense probably damaging 1.00
R3889:Adamts5 UTSW 16 85868121 missense probably damaging 1.00
R4214:Adamts5 UTSW 16 85868643 missense probably damaging 1.00
R4909:Adamts5 UTSW 16 85900066 nonsense probably null
R5119:Adamts5 UTSW 16 85899578 missense probably benign 0.00
R5230:Adamts5 UTSW 16 85870068 missense probably damaging 0.97
R5452:Adamts5 UTSW 16 85869912 critical splice donor site probably benign
R5652:Adamts5 UTSW 16 85899268 missense probably damaging 1.00
R5831:Adamts5 UTSW 16 85868118 missense probably damaging 1.00
R6045:Adamts5 UTSW 16 85899300 missense probably damaging 0.99
R6259:Adamts5 UTSW 16 85899753 missense probably benign 0.03
R6384:Adamts5 UTSW 16 85862828 missense probably benign 0.00
R6724:Adamts5 UTSW 16 85868557 missense probably benign 0.06
R6829:Adamts5 UTSW 16 85870071 missense possibly damaging 0.52
R7066:Adamts5 UTSW 16 85862764 missense probably damaging 1.00
R7293:Adamts5 UTSW 16 85899945 missense probably benign 0.10
R7298:Adamts5 UTSW 16 85899918 missense probably benign 0.35
R7384:Adamts5 UTSW 16 85899826 missense probably benign 0.02
R7452:Adamts5 UTSW 16 85877981 missense probably benign 0.00
R7727:Adamts5 UTSW 16 85899966 missense probably damaging 1.00
R7785:Adamts5 UTSW 16 85863004 missense probably damaging 0.99
R7894:Adamts5 UTSW 16 85877920 nonsense probably null
R8111:Adamts5 UTSW 16 85899315 missense probably damaging 1.00
R8370:Adamts5 UTSW 16 85899993 missense possibly damaging 0.74
R8413:Adamts5 UTSW 16 85866618 critical splice donor site probably null
R8505:Adamts5 UTSW 16 85900056 missense probably benign 0.42
R8804:Adamts5 UTSW 16 85869912 critical splice donor site probably benign
R9209:Adamts5 UTSW 16 85870083 missense probably damaging 1.00
X0062:Adamts5 UTSW 16 85863157 missense probably damaging 1.00
Z1177:Adamts5 UTSW 16 85870074 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGACGTCTAGCGCTTTAGTTG -3'
(R):5'- AGCCCTGTGTAAAGATGGGG -3'

Sequencing Primer
(F):5'- GGGTCTGTGGCAAGGATC -3'
(R):5'- ATGGGGGAAAACTTTTAGAGTAGTTC -3'
Posted On 2019-06-26