Mutagenetix > Incidental Mutation

Incidental Mutation 'R7256:Adamts5'

564301

Institutional Source

Beutler Lab

Gene Symbol

Adamts5

Ensembl Gene

ENSMUSG00000022894

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)

Synonyms

9530092O11Rik, ADAM-TS5

MMRRC Submission

045317-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.267) question?

Stock #

R7256 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85856173-85901828 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85863035 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 790 (Y790H)

Ref Sequence

ENSEMBL: ENSMUSP00000023611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023611]

AlphaFold

Q9R001

Predicted Effect

probably damaging
Transcript: ENSMUST00000023611
AA Change: Y790H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: Y790H

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Pep_M12B_propep	41	182	9.1e-18	PFAM
low complexity region	226	232	N/A	INTRINSIC
Pfam:Reprolysin_5	265	450	2.1e-16	PFAM
Pfam:Reprolysin_4	265	472	4.8e-14	PFAM
Pfam:Reprolysin	267	476	4.6e-26	PFAM
Pfam:Reprolysin_2	286	466	3.7e-13	PFAM
Pfam:Reprolysin_3	288	421	6.9e-17	PFAM
Blast:ACR	477	555	4e-15	BLAST
low complexity region	556	566	N/A	INTRINSIC
TSP1	570	622	6.04e-13	SMART
Pfam:ADAM_spacer1	732	852	1.7e-35	PFAM
TSP1	878	926	7.12e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bend3	A	C	10: 43,493,671	S7R	probably benign	Het
Ccdc106	A	G	7: 5,060,326	T277A	probably damaging	Het
Ccdc162	G	A	10: 41,556,001	A1832V	probably damaging	Het
Ccser1	A	G	6: 61,311,867	E338G	probably benign	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Cecr2	T	C	6: 120,762,529	S1406P	probably benign	Het
Cep290	A	G	10: 100,546,498	T208A	probably damaging	Het
Cep85l	A	C	10: 53,296,255	C569W	probably damaging	Het
Ces5a	G	A	8: 93,499,526	T527I	probably benign	Het
Clca2	T	A	3: 145,090,847	I200F	probably damaging	Het
Cmas	G	A	6: 142,770,586	D251N	probably damaging	Het
Ctcfl	G	T	2: 173,118,475	A105E	probably benign	Het
Dclk2	C	T	3: 86,793,259	R638H	probably damaging	Het
Dctn6	A	T	8: 34,090,808	I170N	probably damaging	Het
Dnah2	T	C	11: 69,431,094	Y3800C	probably damaging	Het
Dsg2	G	A	18: 20,591,931	V465I	possibly damaging	Het
Dzip1	T	C	14: 118,885,646	T646A	probably benign	Het
Etv4	T	A	11: 101,784,325		probably null	Het
Exoc3l2	T	C	7: 19,484,703	V549A	unknown	Het
Ficd	G	T	5: 113,738,819	A352S	probably damaging	Het
Fry	T	G	5: 150,466,786	I179S		Het
Galntl5	A	G	5: 25,195,300	H109R	probably benign	Het
Garem1	C	A	18: 21,148,754	G182W	probably damaging	Het
Gm10696	T	C	3: 94,176,360	E48G	probably benign	Het
Gm13078	T	A	4: 143,726,279	D93E	probably benign	Het
Gm5916	A	T	9: 36,120,989	Y50N	possibly damaging	Het
Gtf2h2	A	T	13: 100,479,201	F271I	probably benign	Het
Hivep2	G	T	10: 14,129,101	S481I	probably benign	Het
Homez	T	A	14: 54,857,420	Q277L	probably damaging	Het
Hoxb4	C	A	11: 96,319,896		probably null	Het
Igll1	A	G	16: 16,861,093	S118P	probably damaging	Het
Ikzf2	A	C	1: 69,578,053		probably null	Het
Kif5b	A	G	18: 6,225,340	V230A	probably damaging	Het
Ldlr	T	A	9: 21,745,744	V719E	probably benign	Het
Lsm7	G	A	10: 80,853,731	R66W	possibly damaging	Het
Map3k13	T	A	16: 21,892,238	D90E	probably benign	Het
Mmrn1	A	G	6: 60,976,114	K460E	probably damaging	Het
Myh10	A	C	11: 68,790,689	N1061H	probably damaging	Het
Nepn	A	G	10: 52,400,993	Q275R	probably benign	Het
Noc3l	A	T	19: 38,812,356	D227E	probably benign	Het
Nploc4	G	T	11: 120,428,550	S61R	probably benign	Het
Nr4a2	T	C	2: 57,112,369	Y24C	probably damaging	Het
Nup160	T	A	2: 90,723,355	I1143N	probably damaging	Het
Olfr1097	A	G	2: 86,890,612	S188P	probably damaging	Het
Olfr1234	A	T	2: 89,362,494	Y312N	probably benign	Het
Olfr294	G	T	7: 86,615,665	H327N	probably benign	Het
Olfr895	T	A	9: 38,268,708	M57K	probably damaging	Het
Papola	T	A	12: 105,809,345	C204S	probably damaging	Het
Peg10	CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG	CCACATCAGGATCCACATCAGGATGCACATCAG	6: 4,756,398		probably benign	Het
Pgap1	A	T	1: 54,493,207		probably null	Het
Pitrm1	A	G	13: 6,556,597	H229R	probably damaging	Het
Plcl1	A	G	1: 55,698,218	Q906R	probably benign	Het
Ppfia3	T	C	7: 45,341,743	N1018S	probably benign	Het
Prkd1	A	G	12: 50,388,342	V534A	possibly damaging	Het
Pygm	A	T	19: 6,385,896	I126F	probably benign	Het
Rag1	T	C	2: 101,642,070	Y909C	probably damaging	Het
Rasgrf2	G	A	13: 91,884,518	Q560*	probably null	Het
Rbp3	A	T	14: 33,962,583	I1190F	possibly damaging	Het
Reln	T	C	5: 21,978,923	K1693E	probably benign	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Rsph3a	A	G	17: 7,946,170	T121A	probably benign	Het
Rufy3	A	G	5: 88,614,947	N112S	possibly damaging	Het
Ryr3	G	A	2: 112,672,246	Q3548*	probably null	Het
Sardh	A	T	2: 27,218,812	V637D	probably benign	Het
Spata16	T	C	3: 26,667,867	V179A	probably benign	Het
Tbc1d30	G	A	10: 121,288,965	T319I	probably damaging	Het
Tlr2	T	A	3: 83,837,606	Q390L	possibly damaging	Het
Tmem53	C	T	4: 117,252,040		probably null	Het
Vmn1r113	T	A	7: 20,787,445	I54N	probably damaging	Het
Vmn1r223	A	C	13: 23,249,866	Y210S	probably damaging	Het
Zbbx	A	T	3: 75,039,898	H670Q	probably benign	Het

Other mutations in Adamts5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01063:Adamts5	APN	16	85899834	missense	probably damaging	1.00
IGL01070:Adamts5	APN	16	85863133	missense	probably damaging	1.00
IGL01321:Adamts5	APN	16	85899475	missense	probably benign	0.03
IGL01616:Adamts5	APN	16	85887814	splice site	probably null
IGL02551:Adamts5	APN	16	85870038	missense	possibly damaging	0.71
IGL03263:Adamts5	APN	16	85869942	missense	probably damaging	0.99
IGL03295:Adamts5	APN	16	85877945	missense	probably damaging	1.00
IGL03393:Adamts5	APN	16	85868195	missense	probably damaging	0.99
IGL03403:Adamts5	APN	16	85863014	missense	probably damaging	0.97
R0414:Adamts5	UTSW	16	85877906	missense	probably damaging	1.00
R0419:Adamts5	UTSW	16	85866642	missense	probably benign	0.00
R0539:Adamts5	UTSW	16	85868692	missense	probably damaging	1.00
R0570:Adamts5	UTSW	16	85899247	missense	probably damaging	1.00
R0574:Adamts5	UTSW	16	85899484	missense	probably damaging	0.99
R0669:Adamts5	UTSW	16	85899726	missense	probably benign	0.45
R1454:Adamts5	UTSW	16	85869993	missense	possibly damaging	0.88
R1498:Adamts5	UTSW	16	85900102	missense	possibly damaging	0.63
R1729:Adamts5	UTSW	16	85877915	nonsense	probably null
R1753:Adamts5	UTSW	16	85899352	missense	probably damaging	1.00
R1784:Adamts5	UTSW	16	85877915	nonsense	probably null
R1906:Adamts5	UTSW	16	85868685	nonsense	probably null
R1946:Adamts5	UTSW	16	85899243	missense	probably damaging	1.00
R2180:Adamts5	UTSW	16	85887924	missense	probably damaging	1.00
R2223:Adamts5	UTSW	16	85899306	missense	probably damaging	1.00
R2366:Adamts5	UTSW	16	85862758	missense	probably damaging	1.00
R3889:Adamts5	UTSW	16	85868121	missense	probably damaging	1.00
R4214:Adamts5	UTSW	16	85868643	missense	probably damaging	1.00
R4909:Adamts5	UTSW	16	85900066	nonsense	probably null
R5119:Adamts5	UTSW	16	85899578	missense	probably benign	0.00
R5230:Adamts5	UTSW	16	85870068	missense	probably damaging	0.97
R5452:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R5652:Adamts5	UTSW	16	85899268	missense	probably damaging	1.00
R5831:Adamts5	UTSW	16	85868118	missense	probably damaging	1.00
R6045:Adamts5	UTSW	16	85899300	missense	probably damaging	0.99
R6259:Adamts5	UTSW	16	85899753	missense	probably benign	0.03
R6384:Adamts5	UTSW	16	85862828	missense	probably benign	0.00
R6724:Adamts5	UTSW	16	85868557	missense	probably benign	0.06
R6829:Adamts5	UTSW	16	85870071	missense	possibly damaging	0.52
R7066:Adamts5	UTSW	16	85862764	missense	probably damaging	1.00
R7293:Adamts5	UTSW	16	85899945	missense	probably benign	0.10
R7298:Adamts5	UTSW	16	85899918	missense	probably benign	0.35
R7384:Adamts5	UTSW	16	85899826	missense	probably benign	0.02
R7452:Adamts5	UTSW	16	85877981	missense	probably benign	0.00
R7727:Adamts5	UTSW	16	85899966	missense	probably damaging	1.00
R7785:Adamts5	UTSW	16	85863004	missense	probably damaging	0.99
R7894:Adamts5	UTSW	16	85877920	nonsense	probably null
R8111:Adamts5	UTSW	16	85899315	missense	probably damaging	1.00
R8370:Adamts5	UTSW	16	85899993	missense	possibly damaging	0.74
R8413:Adamts5	UTSW	16	85866618	critical splice donor site	probably null
R8505:Adamts5	UTSW	16	85900056	missense	probably benign	0.42
R8804:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R9209:Adamts5	UTSW	16	85870083	missense	probably damaging	1.00
R9455:Adamts5	UTSW	16	85870129	missense	probably damaging	0.99
R9616:Adamts5	UTSW	16	85862786	missense	probably benign	0.34
X0062:Adamts5	UTSW	16	85863157	missense	probably damaging	1.00
Z1177:Adamts5	UTSW	16	85870074	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGGACGTCTAGCGCTTTAGTTG -3'
(R):5'- AGCCCTGTGTAAAGATGGGG -3'

Sequencing Primer
(F):5'- GGGTCTGTGGCAAGGATC -3'
(R):5'- ATGGGGGAAAACTTTTAGAGTAGTTC -3'

Posted On

2019-06-26