Mutagenetix > Incidental Mutations

Incidental Mutation 'R7209:Arhgap23'

568664

Institutional Source

Beutler Lab

Gene Symbol

Arhgap23

Ensembl Gene

ENSMUSG00000049807

Gene Name

Rho GTPase activating protein 23

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7209 (G1)

Quality Score

80.0075

Status

Validated

Chromosome

Chromosomal Location

97415533-97502402 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to C at 97492447 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000112999 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056955] [ENSMUST00000093940] [ENSMUST00000107601] [ENSMUST00000121799] [ENSMUST00000142465]

Predicted Effect

probably benign
Transcript: ENSMUST00000056955

SMART Domains

Protein: ENSMUSP00000060323
Gene: ENSMUSG00000047988

Domain	Start	End	E-Value	Type
low complexity region	77	100	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000093940

SMART Domains

Protein: ENSMUSP00000091472
Gene: ENSMUSG00000049807

Domain	Start	End	E-Value	Type
Blast:RhoGAP	72	123	3e-6	BLAST
low complexity region	149	162	N/A	INTRINSIC
low complexity region	173	194	N/A	INTRINSIC
low complexity region	224	242	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000107601

SMART Domains

Protein: ENSMUSP00000103227
Gene: ENSMUSG00000049807

Domain	Start	End	E-Value	Type
low complexity region	246	258	N/A	INTRINSIC
low complexity region	354	369	N/A	INTRINSIC
low complexity region	426	443	N/A	INTRINSIC
PH	479	600	3.2e-12	SMART
low complexity region	679	687	N/A	INTRINSIC
RhoGAP	707	884	6.83e-65	SMART
low complexity region	1051	1066	N/A	INTRINSIC
low complexity region	1101	1114	N/A	INTRINSIC
low complexity region	1125	1146	N/A	INTRINSIC
low complexity region	1176	1194	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000121799

SMART Domains

Protein: ENSMUSP00000112999
Gene: ENSMUSG00000049807

Domain	Start	End	E-Value	Type
low complexity region	8	29	N/A	INTRINSIC
PDZ	52	160	4.2e-17	SMART
low complexity region	457	469	N/A	INTRINSIC
low complexity region	565	580	N/A	INTRINSIC
low complexity region	637	654	N/A	INTRINSIC
PH	690	811	3.2e-12	SMART
low complexity region	890	898	N/A	INTRINSIC
RhoGAP	918	1095	6.83e-65	SMART
low complexity region	1262	1277	N/A	INTRINSIC
low complexity region	1312	1325	N/A	INTRINSIC
low complexity region	1336	1357	N/A	INTRINSIC
low complexity region	1387	1405	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000142465

SMART Domains

Protein: ENSMUSP00000123191
Gene: ENSMUSG00000049807

Domain	Start	End	E-Value	Type
low complexity region	54	69	N/A	INTRINSIC
low complexity region	126	143	N/A	INTRINSIC
PH	179	300	3.2e-12	SMART
low complexity region	379	387	N/A	INTRINSIC
RhoGAP	407	584	6.83e-65	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RHO (see ARHA; MIM 165390) family of small GTPases are involved in signal transduction through transmembrane receptors, and they are inactive in the GDP-bound form and active in the GTP-bound form. GTPase-activating proteins, such as ARHGAP23, inactivate RHO family proteins by stimulating their hydrolysis of GTP (Katoh and Katoh, 2004 [PubMed 15254754]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	C	A	1: 105,750,357	P1136T	probably damaging	Het
Adam7	A	G	14: 68,529,819	Y61H	probably damaging	Het
Adgrb1	T	G	15: 74,569,948	V966G	possibly damaging	Het
Adh5	G	A	3: 138,443,148		probably benign	Het
Akr1b8	T	C	6: 34,356,272	V28A	probably damaging	Het
Apbb1	T	A	7: 105,566,085	I450F	probably damaging	Het
Atg4b	A	G	1: 93,775,233	I128M	probably damaging	Het
B230118H07Rik	T	C	2: 101,566,382	*217W	probably null	Het
Baat	A	T	4: 49,503,065	I19N	probably damaging	Het
Bspry	T	G	4: 62,486,615	I216S	possibly damaging	Het
Commd9	T	A	2: 101,895,138	S19T	possibly damaging	Het
Cr2	A	G	1: 195,168,724	C145R	probably damaging	Het
Cyp2c68	A	G	19: 39,689,205	L447P	probably damaging	Het
Depdc1b	T	C	13: 108,382,855	M333T	possibly damaging	Het
Dhx9	T	C	1: 153,464,623	T710A	possibly damaging	Het
Dnah5	T	C	15: 28,459,225	V4530A	possibly damaging	Het
Dohh	T	A	10: 81,386,040	H89Q	probably damaging	Het
Dopey2	T	A	16: 93,769,845	N1171K	probably benign	Het
Dscam	T	C	16: 96,650,344		probably null	Het
Entpd5	T	A	12: 84,396,928	S14C	probably benign	Het
Eqtn	G	A	4: 94,925,569	S125F	probably damaging	Het
Erp44	A	T	4: 48,211,704	D197E	probably benign	Het
Fgf18	A	T	11: 33,134,315	D46E	probably benign	Het
Foxa1	T	A	12: 57,543,291	M48L	probably benign	Het
Gabrg1	C	A	5: 70,754,170	C417F	probably damaging	Het
Glrp1	T	A	1: 88,503,282	Q122L	unknown	Het
Gm5286	A	T	3: 94,198,705	Q110L	probably benign	Het
Gm5622	A	G	14: 51,655,906	I97V	possibly damaging	Het
Gusb	A	G	5: 129,998,546	V306A	probably benign	Het
Hars	A	G	18: 36,773,540	S126P	probably benign	Het
Herc1	A	G	9: 66,385,032	S356G	possibly damaging	Het
Hydin	C	A	8: 110,489,792	Y1336*	probably null	Het
Kin	T	C	2: 10,091,753	Y138H	possibly damaging	Het
Lypd2	C	T	15: 74,732,417	V101M	probably benign	Het
Madcam1	A	T	10: 79,665,058	T70S	possibly damaging	Het
Man1a2	A	G	3: 100,647,079	C112R	unknown	Het
Mia2	T	A	12: 59,154,390	V198E	possibly damaging	Het
Mpdz	C	T	4: 81,306,877	V1438M	possibly damaging	Het
Mtif2	G	A	11: 29,529,996	V21M	probably benign	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nln	G	A	13: 104,072,898	Q56*	probably null	Het
Nlrp4b	T	C	7: 10,710,370	V82A	probably benign	Het
Obscn	C	A	11: 59,085,107	E2065*	probably null	Het
Olfr1510	A	G	14: 52,410,093	C260R	possibly damaging	Het
Pilrb2	C	T	5: 137,870,864		probably null	Het
Plekhh1	C	A	12: 79,050,376	D99E	probably benign	Het
Polr2b	T	A	5: 77,343,179	F956I	probably damaging	Het
Ppp3cc	A	G	14: 70,267,498	F20L	probably benign	Het
Prmt9	T	C	8: 77,564,998	V333A	probably benign	Het
Psd4	T	C	2: 24,397,345	S430P	probably damaging	Het
Rrp12	A	C	19: 41,872,949	V973G	possibly damaging	Het
Rxfp2	A	G	5: 150,053,098		probably null	Het
S100a6	G	A	3: 90,613,788	A8T	possibly damaging	Het
Sgsm2	C	A	11: 74,854,325	G717V	probably damaging	Het
Sipa1	A	G	19: 5,654,975	Y531H	probably damaging	Het
Slc45a1	A	C	4: 150,635,212		probably null	Het
Srbd1	C	A	17: 86,001,520	L743F	probably damaging	Het
Taar2	A	T	10: 23,940,699	I46F	possibly damaging	Het
Tcrg-C3	A	G	13: 19,261,164	N94S	probably benign	Het
Tmem241	A	T	18: 12,104,172	V69D	probably damaging	Het
Tns1	T	C	1: 73,953,915	S535G	possibly damaging	Het
Ttc34	C	A	4: 154,839,128	P98Q	probably damaging	Het
Ubr1	C	A	2: 120,862,765	R1720L	probably benign	Het
Ubr3	T	A	2: 70,016,134	D1597E	probably benign	Het
Unc79	T	C	12: 103,125,624	M1930T	probably benign	Het
Vmn2r100	A	T	17: 19,531,314	I603F	not run	Het
Vps26b	A	T	9: 27,009,992	S304T	probably benign	Het
Zfp952	A	T	17: 33,003,470	T308S	possibly damaging	Het

Other mutations in Arhgap23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Arhgap23	APN	11	97492671	intron	probably benign
IGL00493:Arhgap23	APN	11	97446553	critical splice donor site	probably null
IGL01729:Arhgap23	APN	11	97453961	missense	probably damaging	1.00
IGL01805:Arhgap23	APN	11	97492602	intron	probably benign
IGL02005:Arhgap23	APN	11	97491219	missense	probably damaging	0.99
IGL02026:Arhgap23	APN	11	97451581	missense	probably damaging	0.99
IGL02135:Arhgap23	APN	11	97451702	missense	probably damaging	0.97
IGL02178:Arhgap23	APN	11	97452353	missense	probably benign	0.42
IGL02226:Arhgap23	APN	11	97451600	missense	probably benign	0.07
IGL02309:Arhgap23	APN	11	97466001	splice site	probably benign
IGL02399:Arhgap23	APN	11	97491005	intron	probably benign
IGL02630:Arhgap23	APN	11	97454297	missense	probably benign	0.24
IGL02724:Arhgap23	APN	11	97491179	missense	probably damaging	0.99
IGL02740:Arhgap23	APN	11	97475017	missense	probably damaging	1.00
IGL02746:Arhgap23	APN	11	97454204	splice site	probably benign
IGL02862:Arhgap23	APN	11	97456480	missense	probably damaging	1.00
IGL03380:Arhgap23	APN	11	97452518	missense	probably damaging	1.00
R0091:Arhgap23	UTSW	11	97452244	missense	probably benign	0.44
R0134:Arhgap23	UTSW	11	97444328	missense	probably benign	0.09
R0225:Arhgap23	UTSW	11	97444328	missense	probably benign	0.09
R0305:Arhgap23	UTSW	11	97501109	missense	probably damaging	0.99
R0358:Arhgap23	UTSW	11	97463588	missense	probably damaging	1.00
R0422:Arhgap23	UTSW	11	97463652	missense	probably damaging	1.00
R0497:Arhgap23	UTSW	11	97452163	missense	probably damaging	1.00
R0580:Arhgap23	UTSW	11	97446536	frame shift	probably null
R0782:Arhgap23	UTSW	11	97500554	missense	possibly damaging	0.73
R1216:Arhgap23	UTSW	11	97492672	intron	probably benign
R1488:Arhgap23	UTSW	11	97500859	missense	possibly damaging	0.53
R1785:Arhgap23	UTSW	11	97451561	missense	possibly damaging	0.77
R1844:Arhgap23	UTSW	11	97463408	missense	probably damaging	1.00
R1855:Arhgap23	UTSW	11	97448697	missense	probably damaging	0.99
R1977:Arhgap23	UTSW	11	97451447	missense	possibly damaging	0.95
R2064:Arhgap23	UTSW	11	97493062	missense	probably benign	0.02
R2130:Arhgap23	UTSW	11	97451561	missense	possibly damaging	0.77
R2431:Arhgap23	UTSW	11	97452404	missense	probably benign
R2853:Arhgap23	UTSW	11	97492594	splice site	probably null
R3767:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R3768:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R3769:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R3770:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R4209:Arhgap23	UTSW	11	97454496	missense	probably damaging	0.99
R4247:Arhgap23	UTSW	11	97463699	missense	probably damaging	1.00
R4997:Arhgap23	UTSW	11	97452020	missense	probably damaging	0.98
R5399:Arhgap23	UTSW	11	97500917	missense	probably damaging	0.97
R5549:Arhgap23	UTSW	11	97466568	missense	probably damaging	0.96
R5655:Arhgap23	UTSW	11	97452546	critical splice donor site	probably null
R5857:Arhgap23	UTSW	11	97451579	missense	possibly damaging	0.93
R6013:Arhgap23	UTSW	11	97500992	missense	probably damaging	0.99
R6031:Arhgap23	UTSW	11	97476139	missense	probably damaging	1.00
R6031:Arhgap23	UTSW	11	97476139	missense	probably damaging	1.00
R6077:Arhgap23	UTSW	11	97491232	critical splice donor site	probably null
R6151:Arhgap23	UTSW	11	97500412	missense	probably benign	0.01
R6393:Arhgap23	UTSW	11	97463672	missense	probably damaging	0.98
R6693:Arhgap23	UTSW	11	97466517	missense	probably damaging	1.00
R6752:Arhgap23	UTSW	11	97452248	missense	probably damaging	0.98
R7202:Arhgap23	UTSW	11	97451993	missense	possibly damaging	0.65
R7209:Arhgap23	UTSW	11	97476085	missense	probably damaging	1.00
R7320:Arhgap23	UTSW	11	97451545	missense	probably benign	0.10
R7345:Arhgap23	UTSW	11	97466478	missense	possibly damaging	0.91
R7599:Arhgap23	UTSW	11	97500343	missense	probably benign
R8229:Arhgap23	UTSW	11	97453906	missense	probably benign	0.36
R8412:Arhgap23	UTSW	11	97466028	missense	probably benign	0.02
R8460:Arhgap23	UTSW	11	97452371	missense	probably damaging	1.00
R8492:Arhgap23	UTSW	11	97475021	missense	probably damaging	1.00
R8525:Arhgap23	UTSW	11	97490084	missense	probably damaging	1.00
RF020:Arhgap23	UTSW	11	97463561	missense	probably damaging	1.00
V8831:Arhgap23	UTSW	11	97456545	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTTGTAATCACCTGCTGCCG -3'
(R):5'- AGGGCCCCACTAAGTTATCAGG -3'

Sequencing Primer
(F):5'- CGCGTGTGGTCAGTCATTC -3'
(R):5'- GGCCCCACTAAGTTATCAGGTAACG -3'

Posted On

2019-09-06