Incidental Mutation 'R7334:Dnal1'
ID 569388
Institutional Source Beutler Lab
Gene Symbol Dnal1
Ensembl Gene ENSMUSG00000042523
Gene Name dynein, axonemal, light chain 1
Synonyms Dnal1, E330027P08Rik, 1700010H15Rik, Dnalc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7334 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 84114366-84147498 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84127006 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 27 (L27P)
Ref Sequence ENSEMBL: ENSMUSP00000037076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046340] [ENSMUST00000123491] [ENSMUST00000136159] [ENSMUST00000156138]
AlphaFold Q05A62
Predicted Effect probably damaging
Transcript: ENSMUST00000046340
AA Change: L27P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037076
Gene: ENSMUSG00000042523
AA Change: L27P

DomainStartEndE-ValueType
Pfam:LRR_1 32 52 8.1e-2 PFAM
Pfam:LRR_4 54 96 3.4e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123491
AA Change: L66P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121038
Gene: ENSMUSG00000042523
AA Change: L66P

DomainStartEndE-ValueType
Pfam:LRR_4 93 135 1.4e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136159
AA Change: L66P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123497
Gene: ENSMUSG00000042523
AA Change: L66P

DomainStartEndE-ValueType
PDB:1DS9|A 1 98 3e-28 PDB
SCOP:d1h6ta2 11 88 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156138
SMART Domains Protein: ENSMUSP00000118584
Gene: ENSMUSG00000042523

DomainStartEndE-ValueType
PDB:1M9L|A 1 50 1e-11 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an axonemal dynein light chain which functions as a component of the outer dynein arms complex. This complex acts as the molecular motor that provides the force to move cilia in an ATP-dependent manner. The encoded protein is expressed in tissues with motile cilia or flagella and may be involved in the movement of sperm flagella. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm G T 3: 153,939,061 S9* probably null Het
Acot10 C T 15: 20,665,543 V371I possibly damaging Het
Adam8 T C 7: 139,988,990 E199G probably damaging Het
Aldh18a1 A T 19: 40,551,252 W762R probably damaging Het
Aldh1a1 T A 19: 20,621,711 V162E probably damaging Het
Alms1 A G 6: 85,641,450 D2357G probably damaging Het
Arfgef1 G T 1: 10,184,460 Q718K probably damaging Het
Arid5b A C 10: 68,243,177 V110G possibly damaging Het
Bpifb3 T A 2: 153,919,734 D34E probably damaging Het
Cacfd1 C T 2: 27,015,546 A85V possibly damaging Het
Cep57l1 C A 10: 41,721,600 S345I probably benign Het
Clca3b G A 3: 144,836,656 R462* probably null Het
Cyp26c1 G A 19: 37,688,875 V251I probably benign Het
Dip2a A G 10: 76,274,246 S1179P possibly damaging Het
Dock7 A G 4: 98,975,943 V1288A unknown Het
Elmod1 A T 9: 53,934,224 probably null Het
Epb41l5 T G 1: 119,623,949 K102T probably damaging Het
Fam92b T C 8: 120,174,850 T39A probably damaging Het
Fermt3 T C 19: 7,003,038 I358V probably benign Het
Frmd3 A G 4: 74,161,718 I316V probably benign Het
Fryl T C 5: 73,047,496 probably null Het
Gm12394 G A 4: 42,793,856 T92I possibly damaging Het
Gm4131 T A 14: 62,464,907 H204L possibly damaging Het
Gm8298 T A 3: 59,868,959 C184S probably damaging Het
Hmcn2 G A 2: 31,435,794 G4278R probably damaging Het
Hmcn2 A G 2: 31,453,135 S4558G possibly damaging Het
Igkv1-132 A G 6: 67,760,124 T25A probably benign Het
Kcp T C 6: 29,485,512 E1161G probably damaging Het
Macf1 A T 4: 123,399,442 I5371K probably damaging Het
Malrd1 T A 2: 16,006,718 C1670S probably damaging Het
Mfsd13a T A 19: 46,368,370 V270E probably damaging Het
Mroh1 A G 15: 76,427,638 I524V probably benign Het
Mta1 T C 12: 113,126,798 S175P possibly damaging Het
Myo7a C T 7: 98,079,366 R800H probably benign Het
Ncald T A 15: 37,397,280 Y52F probably damaging Het
Nomo1 T C 7: 46,083,268 S1152P probably damaging Het
Nr3c1 A G 18: 39,487,037 F66L probably benign Het
Nrf1 T C 6: 30,118,971 L363S probably benign Het
Olfr732 C A 14: 50,281,579 V225F probably benign Het
Olfr875 A T 9: 37,772,997 I113F probably damaging Het
Osbpl3 A G 6: 50,344,906 M300T possibly damaging Het
Parpbp T A 10: 88,111,755 N339I probably damaging Het
Pdlim5 A T 3: 142,244,917 H578Q probably damaging Het
Pear1 T C 3: 87,750,225 N1009S probably damaging Het
Pnpla8 A G 12: 44,311,503 I745M probably damaging Het
Pom121l12 C A 11: 14,599,681 T129K probably damaging Het
Ppp1r14a T C 7: 29,293,262 S130P probably damaging Het
Prss12 A C 3: 123,487,131 L488F probably benign Het
Psd3 C T 8: 67,908,705 V559I possibly damaging Het
Rrh T C 3: 129,808,982 T364A probably benign Het
Shcbp1 A T 8: 4,741,876 M479K probably damaging Het
Shcbp1 A C 8: 4,754,310 F200C probably damaging Het
Slc9a3r1 C T 11: 115,163,767 A81V possibly damaging Het
Slx1b G T 7: 126,692,527 R122S probably damaging Het
Spidr A G 16: 16,114,825 probably null Het
St18 G A 1: 6,802,559 D173N probably benign Het
Stambpl1 T C 19: 34,226,648 I46T probably damaging Het
Syne1 C T 10: 5,057,886 D113N probably damaging Het
Tg G A 15: 66,725,272 V1741I probably benign Het
Thsd7b T A 1: 130,195,275 W1544R probably benign Het
Tiam2 G A 17: 3,503,008 R1120H possibly damaging Het
Tinag A T 9: 77,001,649 C337S probably damaging Het
Tm4sf1 G C 3: 57,293,089 A64G probably damaging Het
Tmprss6 A G 15: 78,443,817 Y572H unknown Het
Tnfrsf11a G A 1: 105,827,129 A309T possibly damaging Het
Txndc11 A G 16: 11,128,561 Y129H probably damaging Het
Ube3b T C 5: 114,415,681 F974S possibly damaging Het
Utrn C A 10: 12,728,009 probably null Het
Vmn1r58 T A 7: 5,411,067 M55L probably benign Het
Vnn1 T A 10: 23,900,760 S336R probably benign Het
Wwc2 T C 8: 47,869,794 Y424C unknown Het
Zfp507 T C 7: 35,776,080 I903V probably damaging Het
Zfp551 C T 7: 12,416,754 G243R probably damaging Het
Zfp60 T A 7: 27,749,019 C371S probably damaging Het
Other mutations in Dnal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02683:Dnal1 APN 12 84138354 missense probably damaging 0.98
IGL02811:Dnal1 APN 12 84131392 splice site probably null
IGL03412:Dnal1 APN 12 84135667 start codon destroyed probably null 1.00
R2421:Dnal1 UTSW 12 84136706 nonsense probably null
R4591:Dnal1 UTSW 12 84133853 missense probably benign 0.00
R4667:Dnal1 UTSW 12 84136700 intron probably benign
R5352:Dnal1 UTSW 12 84136548 missense possibly damaging 0.93
R5922:Dnal1 UTSW 12 84126972 missense probably damaging 0.99
R7450:Dnal1 UTSW 12 84124523 missense probably benign 0.11
R7529:Dnal1 UTSW 12 84131343 missense probably benign
R7585:Dnal1 UTSW 12 84124493 missense probably benign 0.00
R8169:Dnal1 UTSW 12 84124556 missense probably benign 0.00
R8365:Dnal1 UTSW 12 84131389 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GATAACACAAATTGCCCTTTAGTGG -3'
(R):5'- TCAGGTCTCACACTGCTACC -3'

Sequencing Primer
(F):5'- TCAATGAGGGAAAAGATTTCAAAATG -3'
(R):5'- AGGTCTCACACTGCTACCCTTTC -3'
Posted On 2019-09-13