Incidental Mutation 'R7334:Malrd1'
ID 569340
Institutional Source Beutler Lab
Gene Symbol Malrd1
Ensembl Gene ENSMUSG00000075520
Gene Name MAM and LDL receptor class A domain containing 1
Synonyms Gm13364, Gm13318, Diet1
MMRRC Submission 045371-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R7334 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 15531290-16260366 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 16011529 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 1670 (C1670S)
Ref Sequence ENSEMBL: ENSMUSP00000116869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000146205]
AlphaFold A2AJX4
Predicted Effect probably damaging
Transcript: ENSMUST00000146205
AA Change: C1670S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116869
Gene: ENSMUSG00000075520
AA Change: C1670S

DomainStartEndE-ValueType
Pfam:MAM 8 171 1.6e-36 PFAM
LDLa 181 219 6.89e-8 SMART
LDLa 225 262 4.37e-10 SMART
LDLa 264 303 9.55e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm3 T A 3: 59,776,380 (GRCm39) C184S probably damaging Het
Acadm G T 3: 153,644,698 (GRCm39) S9* probably null Het
Acot10 C T 15: 20,665,629 (GRCm39) V371I possibly damaging Het
Adam8 T C 7: 139,568,903 (GRCm39) E199G probably damaging Het
Aldh18a1 A T 19: 40,539,696 (GRCm39) W762R probably damaging Het
Aldh1a1 T A 19: 20,599,075 (GRCm39) V162E probably damaging Het
Alms1 A G 6: 85,618,432 (GRCm39) D2357G probably damaging Het
Arfgef1 G T 1: 10,254,685 (GRCm39) Q718K probably damaging Het
Arid5b A C 10: 68,079,007 (GRCm39) V110G possibly damaging Het
Bpifb3 T A 2: 153,761,654 (GRCm39) D34E probably damaging Het
Cacfd1 C T 2: 26,905,558 (GRCm39) A85V possibly damaging Het
Cep57l1 C A 10: 41,597,596 (GRCm39) S345I probably benign Het
Cibar2 T C 8: 120,901,589 (GRCm39) T39A probably damaging Het
Clca3b G A 3: 144,542,417 (GRCm39) R462* probably null Het
Cyp26c1 G A 19: 37,677,323 (GRCm39) V251I probably benign Het
Dip2a A G 10: 76,110,080 (GRCm39) S1179P possibly damaging Het
Dnal1 T C 12: 84,173,780 (GRCm39) L27P probably damaging Het
Dock7 A G 4: 98,864,180 (GRCm39) V1288A unknown Het
Elmod1 A T 9: 53,841,508 (GRCm39) probably null Het
Epb41l5 T G 1: 119,551,679 (GRCm39) K102T probably damaging Het
Fermt3 T C 19: 6,980,406 (GRCm39) I358V probably benign Het
Frmd3 A G 4: 74,079,955 (GRCm39) I316V probably benign Het
Fryl T C 5: 73,204,839 (GRCm39) probably null Het
Gm4131 T A 14: 62,702,356 (GRCm39) H204L possibly damaging Het
Hmcn2 G A 2: 31,325,806 (GRCm39) G4278R probably damaging Het
Hmcn2 A G 2: 31,343,147 (GRCm39) S4558G possibly damaging Het
Igkv1-132 A G 6: 67,737,108 (GRCm39) T25A probably benign Het
Kcp T C 6: 29,485,511 (GRCm39) E1161G probably damaging Het
Macf1 A T 4: 123,293,235 (GRCm39) I5371K probably damaging Het
Mfsd13a T A 19: 46,356,809 (GRCm39) V270E probably damaging Het
Mroh1 A G 15: 76,311,838 (GRCm39) I524V probably benign Het
Mta1 T C 12: 113,090,418 (GRCm39) S175P possibly damaging Het
Myo7a C T 7: 97,728,573 (GRCm39) R800H probably benign Het
Ncald T A 15: 37,397,524 (GRCm39) Y52F probably damaging Het
Nherf1 C T 11: 115,054,593 (GRCm39) A81V possibly damaging Het
Nomo1 T C 7: 45,732,692 (GRCm39) S1152P probably damaging Het
Nr3c1 A G 18: 39,620,090 (GRCm39) F66L probably benign Het
Nrf1 T C 6: 30,118,970 (GRCm39) L363S probably benign Het
Or4n4 C A 14: 50,519,036 (GRCm39) V225F probably benign Het
Or8b12b A T 9: 37,684,293 (GRCm39) I113F probably damaging Het
Osbpl3 A G 6: 50,321,886 (GRCm39) M300T possibly damaging Het
Parpbp T A 10: 87,947,617 (GRCm39) N339I probably damaging Het
Pdlim5 A T 3: 141,950,678 (GRCm39) H578Q probably damaging Het
Pear1 T C 3: 87,657,532 (GRCm39) N1009S probably damaging Het
Pnpla8 A G 12: 44,358,286 (GRCm39) I745M probably damaging Het
Pom121l12 C A 11: 14,549,681 (GRCm39) T129K probably damaging Het
Ppp1r14a T C 7: 28,992,687 (GRCm39) S130P probably damaging Het
Prss12 A C 3: 123,280,780 (GRCm39) L488F probably benign Het
Psd3 C T 8: 68,361,357 (GRCm39) V559I possibly damaging Het
Rrh T C 3: 129,602,631 (GRCm39) T364A probably benign Het
Shcbp1 A T 8: 4,791,876 (GRCm39) M479K probably damaging Het
Shcbp1 A C 8: 4,804,310 (GRCm39) F200C probably damaging Het
Slx1b G T 7: 126,291,699 (GRCm39) R122S probably damaging Het
Spata31f1e G A 4: 42,793,856 (GRCm39) T92I possibly damaging Het
Spidr A G 16: 15,932,689 (GRCm39) probably null Het
St18 G A 1: 6,872,783 (GRCm39) D173N probably benign Het
Stambpl1 T C 19: 34,204,048 (GRCm39) I46T probably damaging Het
Syne1 C T 10: 5,007,886 (GRCm39) D113N probably damaging Het
Tg G A 15: 66,597,121 (GRCm39) V1741I probably benign Het
Thsd7b T A 1: 130,123,012 (GRCm39) W1544R probably benign Het
Tiam2 G A 17: 3,553,283 (GRCm39) R1120H possibly damaging Het
Tinag A T 9: 76,908,931 (GRCm39) C337S probably damaging Het
Tm4sf1 G C 3: 57,200,510 (GRCm39) A64G probably damaging Het
Tmprss6 A G 15: 78,328,017 (GRCm39) Y572H unknown Het
Tnfrsf11a G A 1: 105,754,854 (GRCm39) A309T possibly damaging Het
Txndc11 A G 16: 10,946,425 (GRCm39) Y129H probably damaging Het
Ube3b T C 5: 114,553,742 (GRCm39) F974S possibly damaging Het
Utrn C A 10: 12,603,753 (GRCm39) probably null Het
Vmn1r58 T A 7: 5,414,066 (GRCm39) M55L probably benign Het
Vnn1 T A 10: 23,776,658 (GRCm39) S336R probably benign Het
Wwc2 T C 8: 48,322,829 (GRCm39) Y424C unknown Het
Zfp507 T C 7: 35,475,505 (GRCm39) I903V probably damaging Het
Zfp551 C T 7: 12,150,681 (GRCm39) G243R probably damaging Het
Zfp60 T A 7: 27,448,444 (GRCm39) C371S probably damaging Het
Other mutations in Malrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Malrd1 APN 2 16,146,997 (GRCm39) splice site probably benign
IGL01295:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01296:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01399:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01400:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01401:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01402:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01405:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01406:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL02105:Malrd1 APN 2 16,132,674 (GRCm39) missense unknown
IGL02581:Malrd1 APN 2 16,147,123 (GRCm39) nonsense probably null
IGL03015:Malrd1 APN 2 16,047,082 (GRCm39) missense unknown
IGL03038:Malrd1 APN 2 16,132,778 (GRCm39) missense unknown
R1353:Malrd1 UTSW 2 16,132,779 (GRCm39) missense unknown
R1385:Malrd1 UTSW 2 16,047,039 (GRCm39) missense unknown
R2242:Malrd1 UTSW 2 16,106,755 (GRCm39) missense unknown
R2888:Malrd1 UTSW 2 16,079,568 (GRCm39) missense unknown
R4398:Malrd1 UTSW 2 16,155,594 (GRCm39) missense unknown
R4982:Malrd1 UTSW 2 16,046,940 (GRCm39) missense probably benign 0.29
R5148:Malrd1 UTSW 2 16,147,037 (GRCm39) missense unknown
R5195:Malrd1 UTSW 2 16,155,621 (GRCm39) missense unknown
R5828:Malrd1 UTSW 2 15,531,464 (GRCm39) missense probably benign 0.00
R5892:Malrd1 UTSW 2 15,619,078 (GRCm39) missense probably benign 0.03
R6034:Malrd1 UTSW 2 15,850,137 (GRCm39) missense possibly damaging 0.78
R6034:Malrd1 UTSW 2 15,850,137 (GRCm39) missense possibly damaging 0.78
R6195:Malrd1 UTSW 2 15,700,137 (GRCm39) missense probably damaging 1.00
R6318:Malrd1 UTSW 2 16,047,078 (GRCm39) missense unknown
R6438:Malrd1 UTSW 2 15,619,017 (GRCm39) missense
R6457:Malrd1 UTSW 2 15,672,740 (GRCm39) missense probably benign 0.41
R6457:Malrd1 UTSW 2 15,531,408 (GRCm39) start gained probably benign
R6499:Malrd1 UTSW 2 15,936,500 (GRCm39) missense probably benign 0.03
R6575:Malrd1 UTSW 2 15,847,439 (GRCm39) missense probably benign 0.00
R6792:Malrd1 UTSW 2 16,155,567 (GRCm39) missense unknown
R6796:Malrd1 UTSW 2 15,874,595 (GRCm39) missense unknown
R6930:Malrd1 UTSW 2 15,802,478 (GRCm39) missense unknown
R6959:Malrd1 UTSW 2 16,222,820 (GRCm39) missense probably damaging 0.97
R6993:Malrd1 UTSW 2 16,155,602 (GRCm39) missense unknown
R7102:Malrd1 UTSW 2 16,147,114 (GRCm39) missense unknown
R7112:Malrd1 UTSW 2 15,929,987 (GRCm39) missense unknown
R7248:Malrd1 UTSW 2 16,106,722 (GRCm39) missense unknown
R7249:Malrd1 UTSW 2 15,628,151 (GRCm39) missense probably damaging 0.97
R7394:Malrd1 UTSW 2 15,700,010 (GRCm39) missense unknown
R7399:Malrd1 UTSW 2 15,614,901 (GRCm39) missense
R7476:Malrd1 UTSW 2 16,147,115 (GRCm39) missense unknown
R7582:Malrd1 UTSW 2 15,700,081 (GRCm39) missense unknown
R7604:Malrd1 UTSW 2 15,930,003 (GRCm39) missense unknown
R7662:Malrd1 UTSW 2 15,876,265 (GRCm39) missense unknown
R7681:Malrd1 UTSW 2 16,222,913 (GRCm39) missense unknown
R7740:Malrd1 UTSW 2 15,619,026 (GRCm39) missense not run
R7747:Malrd1 UTSW 2 16,079,646 (GRCm39) missense unknown
R7754:Malrd1 UTSW 2 15,802,610 (GRCm39) splice site probably null
R7950:Malrd1 UTSW 2 16,132,879 (GRCm39) missense unknown
R8194:Malrd1 UTSW 2 15,929,931 (GRCm39) missense unknown
R8260:Malrd1 UTSW 2 15,619,017 (GRCm39) missense
R8314:Malrd1 UTSW 2 15,757,643 (GRCm39) missense unknown
R8342:Malrd1 UTSW 2 15,638,035 (GRCm39) missense unknown
R8386:Malrd1 UTSW 2 15,701,655 (GRCm39) missense unknown
R8492:Malrd1 UTSW 2 15,614,934 (GRCm39) missense
R8728:Malrd1 UTSW 2 15,701,753 (GRCm39) nonsense probably null
R8756:Malrd1 UTSW 2 15,757,706 (GRCm39) critical splice donor site probably null
R8869:Malrd1 UTSW 2 15,570,368 (GRCm39) critical splice donor site probably null
R8888:Malrd1 UTSW 2 15,850,038 (GRCm39) missense unknown
R8895:Malrd1 UTSW 2 15,850,038 (GRCm39) missense unknown
R8902:Malrd1 UTSW 2 16,260,145 (GRCm39) nonsense probably null
R8954:Malrd1 UTSW 2 15,556,178 (GRCm39) missense
R8960:Malrd1 UTSW 2 15,570,241 (GRCm39) nonsense probably null
R9005:Malrd1 UTSW 2 15,850,140 (GRCm39) missense unknown
R9135:Malrd1 UTSW 2 15,802,516 (GRCm39) missense unknown
R9267:Malrd1 UTSW 2 16,260,077 (GRCm39) missense unknown
R9330:Malrd1 UTSW 2 16,260,089 (GRCm39) missense unknown
R9359:Malrd1 UTSW 2 15,618,988 (GRCm39) missense
R9383:Malrd1 UTSW 2 15,700,012 (GRCm39) missense unknown
R9389:Malrd1 UTSW 2 15,707,967 (GRCm39) missense unknown
R9403:Malrd1 UTSW 2 15,618,988 (GRCm39) missense
R9454:Malrd1 UTSW 2 15,802,537 (GRCm39) nonsense probably null
R9454:Malrd1 UTSW 2 15,757,660 (GRCm39) missense unknown
R9520:Malrd1 UTSW 2 16,079,631 (GRCm39) missense unknown
R9544:Malrd1 UTSW 2 15,640,809 (GRCm39) missense unknown
R9609:Malrd1 UTSW 2 15,700,081 (GRCm39) missense unknown
R9667:Malrd1 UTSW 2 15,570,026 (GRCm39) critical splice acceptor site probably null
R9721:Malrd1 UTSW 2 15,701,638 (GRCm39) missense unknown
R9787:Malrd1 UTSW 2 15,625,401 (GRCm39) missense unknown
R9800:Malrd1 UTSW 2 15,847,405 (GRCm39) missense unknown
Z1176:Malrd1 UTSW 2 16,222,656 (GRCm39) missense unknown
Z1191:Malrd1 UTSW 2 16,047,037 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AAGTCTACCTTGGGCAGTTG -3'
(R):5'- CACATGTTCGAATAAGAGTCCTG -3'

Sequencing Primer
(F):5'- TCTTAAACCGTATGGCAATA -3'
(R):5'- GGTCCTCACACTTACATTGGAAGTG -3'
Posted On 2019-09-13