Incidental Mutation 'R7351:Zfp592'
ID 570573
Institutional Source Beutler Lab
Gene Symbol Zfp592
Ensembl Gene ENSMUSG00000005621
Gene Name zinc finger protein 592
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.934) question?
Stock # R7351 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 80993681-81045164 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 81041691 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1206 (V1206A)
Ref Sequence ENSEMBL: ENSMUSP00000102976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107353]
AlphaFold Q8BHZ4
Predicted Effect probably benign
Transcript: ENSMUST00000107353
AA Change: V1206A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102976
Gene: ENSMUSG00000005621
AA Change: V1206A

DomainStartEndE-ValueType
low complexity region 170 180 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 314 333 N/A INTRINSIC
low complexity region 343 369 N/A INTRINSIC
low complexity region 484 500 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
ZnF_C2H2 587 612 8.98e0 SMART
ZnF_C2H2 615 639 2.61e1 SMART
low complexity region 664 686 N/A INTRINSIC
ZnF_C2H2 711 731 1.24e2 SMART
ZnF_C2H2 740 762 2.82e0 SMART
ZnF_C2H2 768 792 4.99e1 SMART
ZnF_C2H2 799 822 1.73e0 SMART
ZnF_C2H2 827 850 7.89e0 SMART
ZnF_C2H2 892 915 3.89e-3 SMART
low complexity region 924 935 N/A INTRINSIC
low complexity region 965 979 N/A INTRINSIC
ZnF_C2H2 983 1006 4.11e-2 SMART
ZnF_C2H2 1013 1036 7.37e-4 SMART
ZnF_C2H2 1043 1069 7.68e0 SMART
ZnF_C2H2 1124 1146 1.51e0 SMART
ZnF_C2H2 1153 1176 1.23e0 SMART
Meta Mutation Damage Score 0.0642 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play a role in a complex developmental pathway and the regulation of genes involved in cerebellar development. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,412,510 G343V probably damaging Het
1700006E09Rik A G 11: 101,991,505 E163G probably benign Het
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Adamts6 G A 13: 104,390,112 S516N possibly damaging Het
Ahi1 A G 10: 20,965,933 D301G probably damaging Het
Arhgef37 T A 18: 61,498,215 L566F possibly damaging Het
AU040320 A G 4: 126,816,444 N328D probably damaging Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Brk1 T C 6: 113,615,781 S42P probably benign Het
Ccdc180 A G 4: 45,903,887 E351G possibly damaging Het
Cenpo A T 12: 4,216,581 F176I probably damaging Het
Clec12b A G 6: 129,379,911 probably null Het
Ddx42 A G 11: 106,247,682 N769S probably benign Het
Drc7 A G 8: 95,058,507 D165G probably benign Het
Dync2h1 A T 9: 7,167,145 I486N probably damaging Het
Gmip A G 8: 69,817,384 D679G probably benign Het
Gml2 T C 15: 74,821,376 V76A possibly damaging Het
Gpr26 T C 7: 131,974,365 C253R probably damaging Het
H2-Q4 A G 17: 35,382,878 T239A possibly damaging Het
Hmcn1 T A 1: 150,667,889 Y2845F probably damaging Het
Ift172 A G 5: 31,275,896 Y550H probably damaging Het
Irgm2 G A 11: 58,219,605 V41M possibly damaging Het
Lrp2 C T 2: 69,448,142 G3956R probably damaging Het
Matn2 G A 15: 34,345,336 R163H probably damaging Het
Mxd1 A G 6: 86,651,466 S151P probably damaging Het
Olfr1022 G T 2: 85,864,071 probably benign Het
Olfr1246 C T 2: 89,590,513 G201S probably benign Het
Olfr1330 T C 4: 118,893,836 V251A probably benign Het
Olfr147 C T 9: 38,403,443 L190F probably damaging Het
Plcg2 A G 8: 117,590,310 E642G possibly damaging Het
Pramel6 T A 2: 87,510,328 F335I probably benign Het
Psd G T 19: 46,322,430 S393R probably benign Het
Pwwp2a A G 11: 43,682,280 D63G probably benign Het
Rbm28 T C 6: 29,158,880 T139A probably benign Het
Ripk2 T G 4: 16,155,048 E157A probably damaging Het
Rnf145 G A 11: 44,548,796 V140I possibly damaging Het
Rnf38 T C 4: 44,149,102 N114D probably benign Het
Samd9l G A 6: 3,374,157 R1035C probably benign Het
Sec14l3 A G 11: 4,074,785 T245A probably benign Het
Serpina10 A T 12: 103,628,935 F8L probably benign Het
Slc16a8 T A 15: 79,253,641 D56V probably damaging Het
Spag9 A T 11: 94,092,976 E726D probably benign Het
Spg11 A G 2: 122,069,931 F1547L possibly damaging Het
Sspo T C 6: 48,464,921 I1955T possibly damaging Het
Stx18 T A 5: 38,039,411 V27E probably benign Het
Taf1c A G 8: 119,599,000 S708P probably damaging Het
Tas2r126 T C 6: 42,435,306 F258L probably benign Het
Tdpoz2 C T 3: 93,652,593 W24* probably null Het
Tmc8 T C 11: 117,783,828 L123P probably damaging Het
Trmo A T 4: 46,387,716 Y35N possibly damaging Het
Ttn C T 2: 76,767,686 V19628I possibly damaging Het
Ttn G A 2: 76,939,930 A2685V unknown Het
Usp15 A T 10: 123,132,999 M349K probably damaging Het
Vmn2r89 A G 14: 51,456,282 N363S probably benign Het
Vwa3a T A 7: 120,776,336 I423N probably damaging Het
Zfp866 A T 8: 69,765,897 Y358N probably damaging Het
Other mutations in Zfp592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Zfp592 APN 7 81041548 nonsense probably null
IGL01984:Zfp592 APN 7 81038644 missense probably benign 0.00
IGL02079:Zfp592 APN 7 81039230 missense probably benign 0.20
IGL02096:Zfp592 APN 7 81025048 missense probably damaging 1.00
IGL02125:Zfp592 APN 7 81038184 missense probably benign 0.00
IGL02374:Zfp592 APN 7 81024983 missense probably damaging 1.00
IGL02419:Zfp592 APN 7 81038245 missense probably damaging 1.00
IGL02466:Zfp592 APN 7 81023998 missense probably damaging 1.00
IGL02485:Zfp592 APN 7 81037970 splice site probably benign
IGL02500:Zfp592 APN 7 81041726 missense probably benign
IGL02876:Zfp592 APN 7 81038127 missense probably benign 0.01
IGL02940:Zfp592 APN 7 81024827 missense probably damaging 1.00
R0326:Zfp592 UTSW 7 81024889 missense possibly damaging 0.83
R0634:Zfp592 UTSW 7 81038071 missense probably damaging 1.00
R0684:Zfp592 UTSW 7 81037875 missense probably benign 0.00
R0750:Zfp592 UTSW 7 81024745 missense probably benign
R1346:Zfp592 UTSW 7 81038064 missense possibly damaging 0.54
R1457:Zfp592 UTSW 7 81024479 missense probably damaging 0.99
R1650:Zfp592 UTSW 7 81038100 missense probably benign 0.04
R1804:Zfp592 UTSW 7 81023695 missense probably damaging 1.00
R1918:Zfp592 UTSW 7 81037420 nonsense probably null
R2114:Zfp592 UTSW 7 81024796 missense probably damaging 1.00
R2144:Zfp592 UTSW 7 81038202 missense probably benign 0.01
R2164:Zfp592 UTSW 7 81041438 missense possibly damaging 0.87
R2246:Zfp592 UTSW 7 81041613 missense possibly damaging 0.91
R3701:Zfp592 UTSW 7 81037411 nonsense probably null
R3809:Zfp592 UTSW 7 81024532 missense probably benign 0.00
R4574:Zfp592 UTSW 7 81023786 missense possibly damaging 0.87
R4866:Zfp592 UTSW 7 81041859 missense probably damaging 1.00
R5023:Zfp592 UTSW 7 81024347 missense probably damaging 1.00
R5121:Zfp592 UTSW 7 81023561 missense probably damaging 1.00
R5174:Zfp592 UTSW 7 81038325 missense probably damaging 1.00
R5794:Zfp592 UTSW 7 81025033 missense probably benign 0.00
R5946:Zfp592 UTSW 7 81037897 missense possibly damaging 0.95
R6312:Zfp592 UTSW 7 81023436 missense probably benign 0.05
R6657:Zfp592 UTSW 7 81025486 missense possibly damaging 0.49
R6814:Zfp592 UTSW 7 81023828 missense probably benign 0.02
R6872:Zfp592 UTSW 7 81023828 missense probably benign 0.02
R7056:Zfp592 UTSW 7 81023319 missense probably damaging 1.00
R7295:Zfp592 UTSW 7 81024322 missense probably damaging 1.00
R7475:Zfp592 UTSW 7 81023452 missense probably damaging 0.99
R7509:Zfp592 UTSW 7 81038340 missense probably damaging 0.99
R7552:Zfp592 UTSW 7 81023642 missense probably benign 0.01
R7737:Zfp592 UTSW 7 81025193 missense probably damaging 1.00
R7752:Zfp592 UTSW 7 81024721 missense probably benign 0.13
R7901:Zfp592 UTSW 7 81024721 missense probably benign 0.13
R8100:Zfp592 UTSW 7 81024192 missense probably benign 0.05
R8440:Zfp592 UTSW 7 81041523 missense possibly damaging 0.89
R8710:Zfp592 UTSW 7 81023573 missense probably damaging 1.00
R8766:Zfp592 UTSW 7 81024605 missense probably benign 0.00
R9083:Zfp592 UTSW 7 81024896 missense possibly damaging 0.95
R9141:Zfp592 UTSW 7 81024457 missense probably damaging 1.00
R9194:Zfp592 UTSW 7 81024601 missense probably benign
R9197:Zfp592 UTSW 7 81024319 missense possibly damaging 0.73
R9246:Zfp592 UTSW 7 81041781 missense probably benign 0.03
R9321:Zfp592 UTSW 7 81041478 missense possibly damaging 0.65
R9426:Zfp592 UTSW 7 81024457 missense probably damaging 1.00
R9785:Zfp592 UTSW 7 81023497 missense probably damaging 1.00
X0022:Zfp592 UTSW 7 81038187 nonsense probably null
X0028:Zfp592 UTSW 7 81024014 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTGCACCTTCGCCACAG -3'
(R):5'- CACCTGAGGAGATAGTGCATG -3'

Sequencing Primer
(F):5'- GCCACAGACTCGGAACTTGAG -3'
(R):5'- AGGAGATAGTGCATGGCTGTTC -3'
Posted On 2019-09-13