Incidental Mutation 'R7452:Enpp2'
ID577827
Institutional Source Beutler Lab
Gene Symbol Enpp2
Ensembl Gene ENSMUSG00000022425
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 2
SynonymsPdnp2, Npps2, PD-Ialpha, ATX, Autotaxin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7452 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location54838901-54952892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54866736 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 462 (N462S)
Ref Sequence ENSEMBL: ENSMUSP00000128941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041591] [ENSMUST00000167541] [ENSMUST00000171545] [ENSMUST00000173516]
PDB Structure
Crystal structure of mouse autotaxin [X-RAY DIFFRACTION]
Crystal structure of mouse autotaxin in complex with 14:0-LPA [X-RAY DIFFRACTION]
Crystal structure of mouse autotaxin in complex with 16:0-LPA [X-RAY DIFFRACTION]
Crystal structure of mouse autotaxin in complex with 18:1-LPA [X-RAY DIFFRACTION]
Crystal structure of mouse autotaxin in complex with 18:3-LPA [X-RAY DIFFRACTION]
Crystal structure of mouse autotaxin in complex with 22:6-LPA [X-RAY DIFFRACTION]
Crystal Structure of Autotaxin in Complex with Compound 10 [X-RAY DIFFRACTION]
Crystal Structure of Autotaxin in Complex with 2BoA [X-RAY DIFFRACTION]
Crystal Structure of Autotaxin in Complex with 3BoA [X-RAY DIFFRACTION]
Crystal Structure of Autotaxin in Complex with 4BoA [X-RAY DIFFRACTION]
>> 4 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000041591
AA Change: N410S

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000036180
Gene: ENSMUSG00000022425
AA Change: N410S

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 285 4.7e-41 PFAM
Pfam:Phosphodiest 278 477 3.3e-40 PFAM
Endonuclease_NS 613 844 3.93e-36 SMART
NUC 614 844 1.32e-109 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167541
AA Change: N410S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132640
Gene: ENSMUSG00000022425
AA Change: N410S

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 284 5.4e-41 PFAM
Pfam:Phosphodiest 278 477 3.4e-40 PFAM
Endonuclease_NS 638 869 3.93e-36 SMART
NUC 639 869 1.32e-109 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171545
AA Change: N462S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128941
Gene: ENSMUSG00000022425
AA Change: N462S

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 283 2.8e-43 PFAM
Pfam:Phosphodiest 275 529 2.8e-36 PFAM
Endonuclease_NS 665 896 3.93e-36 SMART
NUC 666 896 1.32e-109 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173516
AA Change: N462S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133877
Gene: ENSMUSG00000022425
AA Change: N462S

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 285 2.8e-41 PFAM
Pfam:Phosphodiest 276 529 7.8e-36 PFAM
Endonuclease_NS 661 892 3.93e-36 SMART
NUC 662 892 1.32e-109 SMART
Meta Mutation Damage Score 0.4111 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: This gene encodes a member of the phosphodiesterase and nucleotide pyrophosphatase family of bifunctional enzymes that hydrolize phosphodiester bonds of various nucleotides. The encoded protein undergoes proteolytic processing to generate a mature protein with lysophospholipase D activity, catalyzing the cleavage of the choline group from lysophosphatidylcholine to produce lysophosphatidic acid. This gene is expressed in numerous tissues and participates in neural development, obesity, inflammation and oncogenesis. A complete lack of the encoded protein in mice results in aberrant vascular and neuronal development leading to embryonic lethality. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, absent yolk sac vasculature, abnormal vasculature, and variable penetrance of impaired embryo turning, edema, failure of chorioallantoic fusion, neural tube malformations, and abnormal forebrain development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,245,671 S595P probably benign Het
A2m C A 6: 121,641,332 Q195K probably damaging Het
Abcg4 C T 9: 44,279,600 G249R probably damaging Het
Actn1 T C 12: 80,183,602 T293A probably benign Het
Adamts5 T A 16: 85,877,981 T432S probably benign Het
Adh5 A G 3: 138,454,745 T347A probably benign Het
Agbl5 A G 5: 30,893,391 D432G probably damaging Het
Ank3 A G 10: 69,899,051 T797A possibly damaging Het
Aoc1 T G 6: 48,908,790 V743G probably benign Het
Arap2 A T 5: 62,676,549 S858R probably benign Het
Arid1a A C 4: 133,753,127 V162G possibly damaging Het
Armc9 A G 1: 86,213,092 D588G possibly damaging Het
Art3 A G 5: 92,392,680 Y94C probably damaging Het
Btaf1 T A 19: 36,969,127 D444E probably damaging Het
Cav2 A G 6: 17,282,076 H111R probably damaging Het
Ccdc148 A G 2: 58,827,584 L469P probably damaging Het
Celsr2 T A 3: 108,413,090 E802V possibly damaging Het
Cfap57 T C 4: 118,595,784 D574G probably damaging Het
Chd7 A C 4: 8,854,731 D2024A probably benign Het
Corin T A 5: 72,435,247 D269V possibly damaging Het
Cyp4a12a A T 4: 115,327,598 I359F probably damaging Het
Defb6 T C 8: 19,225,524 L7P probably damaging Het
Dnah7c A T 1: 46,647,036 M1817L possibly damaging Het
Dock3 A G 9: 106,989,465 F682S probably damaging Het
Enpep T A 3: 129,271,403 Y879F possibly damaging Het
Ephb3 T C 16: 21,217,357 probably null Het
F7 C T 8: 13,035,215 H414Y probably benign Het
Fbn1 T C 2: 125,505,455 H50R possibly damaging Het
Fig4 T C 10: 41,240,637 D586G possibly damaging Het
Fryl A G 5: 73,023,988 L2825P probably damaging Het
Gal3st2 T A 1: 93,872,518 H30Q possibly damaging Het
Gm12886 G A 4: 121,417,474 Q70* probably null Het
Gm8104 A C 14: 43,110,044 T190P probably benign Het
Hps3 A T 3: 20,011,428 N749K probably damaging Het
Hr A G 14: 70,571,486 T1101A probably damaging Het
Htatip2 T A 7: 49,773,326 S210T probably benign Het
Ift80 T C 3: 68,994,282 probably null Het
Iqgap1 A G 7: 80,760,829 V212A possibly damaging Het
Itih5 A G 2: 10,238,796 E448G probably damaging Het
Kdm5b T C 1: 134,624,948 C1221R probably damaging Het
Lrrc72 T C 12: 36,212,693 Y52C probably benign Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mdn1 T C 4: 32,739,030 I3617T possibly damaging Het
Mtpap T A 18: 4,379,705 H98Q possibly damaging Het
Nemf A T 12: 69,337,959 probably null Het
Neto1 A T 18: 86,498,931 I458L probably benign Het
Nfam1 T A 15: 83,014,962 M128L probably benign Het
Olfr1279 A G 2: 111,306,921 T239A probably damaging Het
Olfr1383 C A 11: 49,524,381 H219Q probably benign Het
Olfr501-ps1 C T 7: 108,508,593 T179I unknown Het
Olfr914 A T 9: 38,607,088 I208F probably benign Het
P2ry14 C T 3: 59,116,045 G7D probably benign Het
Pde11a A G 2: 76,136,414 Y564H probably damaging Het
Pex5l C T 3: 33,004,318 V262I probably benign Het
Poli A G 18: 70,508,978 V717A possibly damaging Het
Prdm14 A T 1: 13,125,559 W93R probably damaging Het
Rbm46 T C 3: 82,864,121 M396V probably benign Het
Rcor2 T C 19: 7,271,222 V212A probably benign Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Skp2 T A 15: 9,113,832 Q366L probably damaging Het
Slc13a3 A T 2: 165,427,114 S312T probably benign Het
Sstr1 T C 12: 58,213,356 L255P probably damaging Het
Steap3 T C 1: 120,227,855 E458G possibly damaging Het
Sv2b T A 7: 75,147,713 D311V probably damaging Het
Tmem132b A G 5: 125,638,268 D347G probably benign Het
Tmem161a A G 8: 70,177,488 D108G probably damaging Het
Traf5 T A 1: 191,999,831 I47F Het
Trp53bp2 C T 1: 182,446,568 Q95* probably null Het
Ttn G T 2: 76,877,143 probably null Het
Usf3 T C 16: 44,220,034 S1626P probably benign Het
Usp3 T C 9: 66,566,898 R33G probably benign Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Other mutations in Enpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Enpp2 APN 15 54875650 critical splice donor site probably null
IGL01290:Enpp2 APN 15 54919602 missense possibly damaging 0.79
IGL01296:Enpp2 APN 15 54875669 missense probably damaging 1.00
IGL01650:Enpp2 APN 15 54919933 missense probably benign
IGL02470:Enpp2 APN 15 54839460 missense probably damaging 1.00
IGL02522:Enpp2 APN 15 54898940 missense probably damaging 0.99
IGL02727:Enpp2 APN 15 54910181 missense probably damaging 1.00
IGL03178:Enpp2 APN 15 54866006 missense probably benign
IGL03055:Enpp2 UTSW 15 54866085 splice site probably null
PIT4260001:Enpp2 UTSW 15 54844378 critical splice donor site probably null
R0302:Enpp2 UTSW 15 54860061 missense probably benign 0.15
R0304:Enpp2 UTSW 15 54877806 missense probably benign 0.07
R0385:Enpp2 UTSW 15 54882159 missense probably damaging 1.00
R0440:Enpp2 UTSW 15 54847237 splice site probably benign
R0696:Enpp2 UTSW 15 54897696 nonsense probably null
R0879:Enpp2 UTSW 15 54877930 missense probably damaging 0.98
R0924:Enpp2 UTSW 15 54906959 splice site probably benign
R0989:Enpp2 UTSW 15 54875759 missense possibly damaging 0.88
R1126:Enpp2 UTSW 15 54906826 critical splice donor site probably null
R1434:Enpp2 UTSW 15 54862681 missense probably damaging 1.00
R1447:Enpp2 UTSW 15 54919598 critical splice donor site probably null
R1464:Enpp2 UTSW 15 54863812 missense probably damaging 1.00
R1464:Enpp2 UTSW 15 54863812 missense probably damaging 1.00
R1501:Enpp2 UTSW 15 54839514 missense probably damaging 1.00
R1546:Enpp2 UTSW 15 54845829 missense probably benign 0.01
R1673:Enpp2 UTSW 15 54910196 splice site probably null
R1853:Enpp2 UTSW 15 54845823 missense probably damaging 1.00
R1854:Enpp2 UTSW 15 54845823 missense probably damaging 1.00
R1855:Enpp2 UTSW 15 54845823 missense probably damaging 1.00
R1969:Enpp2 UTSW 15 54882982 missense probably damaging 1.00
R1970:Enpp2 UTSW 15 54882982 missense probably damaging 1.00
R2060:Enpp2 UTSW 15 54875714 missense probably damaging 1.00
R2122:Enpp2 UTSW 15 54897792 nonsense probably null
R2275:Enpp2 UTSW 15 54897794 missense probably damaging 1.00
R2517:Enpp2 UTSW 15 54919694 missense probably damaging 0.99
R3881:Enpp2 UTSW 15 54919692 missense probably damaging 1.00
R3934:Enpp2 UTSW 15 54845921 missense probably benign 0.03
R4722:Enpp2 UTSW 15 54887589 missense probably damaging 0.99
R4765:Enpp2 UTSW 15 54875672 missense possibly damaging 0.91
R4799:Enpp2 UTSW 15 54910094 missense probably damaging 1.00
R4934:Enpp2 UTSW 15 54882147 missense probably damaging 1.00
R4976:Enpp2 UTSW 15 54870305 nonsense probably null
R5068:Enpp2 UTSW 15 54864054 missense probably damaging 1.00
R5069:Enpp2 UTSW 15 54864054 missense probably damaging 1.00
R5070:Enpp2 UTSW 15 54864054 missense probably damaging 1.00
R5119:Enpp2 UTSW 15 54870305 nonsense probably null
R5134:Enpp2 UTSW 15 54899330 missense probably damaging 1.00
R5162:Enpp2 UTSW 15 54847296 missense probably benign 0.06
R5218:Enpp2 UTSW 15 54887586 missense possibly damaging 0.86
R5415:Enpp2 UTSW 15 54882156 missense probably damaging 1.00
R5965:Enpp2 UTSW 15 54882971 critical splice donor site probably null
R6086:Enpp2 UTSW 15 54845834 missense probably damaging 1.00
R6229:Enpp2 UTSW 15 54877832 missense probably damaging 1.00
R6306:Enpp2 UTSW 15 54899346 missense probably damaging 1.00
R6314:Enpp2 UTSW 15 54865970 missense probably damaging 0.99
R6403:Enpp2 UTSW 15 54863764 missense probably damaging 1.00
R6515:Enpp2 UTSW 15 54860093 missense possibly damaging 0.75
R6525:Enpp2 UTSW 15 54870211 missense probably benign 0.01
R6536:Enpp2 UTSW 15 54862631 missense probably damaging 1.00
R7070:Enpp2 UTSW 15 54899289 missense probably damaging 1.00
R7077:Enpp2 UTSW 15 54901391 missense probably benign 0.36
R7265:Enpp2 UTSW 15 54910033 critical splice donor site probably null
R7324:Enpp2 UTSW 15 54877774 critical splice donor site probably null
R7331:Enpp2 UTSW 15 54875670 missense probably damaging 1.00
R7494:Enpp2 UTSW 15 54910158 missense probably damaging 1.00
R7557:Enpp2 UTSW 15 54910140 missense probably damaging 1.00
R7574:Enpp2 UTSW 15 54851417 missense probably benign
R7665:Enpp2 UTSW 15 54839394 missense probably damaging 0.98
R7744:Enpp2 UTSW 15 54901233 splice site probably null
R7940:Enpp2 UTSW 15 54906928 missense probably damaging 1.00
R7942:Enpp2 UTSW 15 54845879 missense probably damaging 1.00
R7951:Enpp2 UTSW 15 54919693 missense probably benign 0.00
R8069:Enpp2 UTSW 15 54847301 missense probably damaging 0.96
R8301:Enpp2 UTSW 15 54851407 missense probably benign
R8376:Enpp2 UTSW 15 54910095 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTGGGGAGTCTTCAGCTG -3'
(R):5'- CATACGTTGCAAGAGCTGTGG -3'

Sequencing Primer
(F):5'- GACCTCGGTCCAGAAGTTTTGAAAG -3'
(R):5'- ACTGGTTTAGCTACTCCTGTTATTAG -3'
Posted On2019-10-07