Incidental Mutation 'R7458:Ccne1'
ID578248
Institutional Source Beutler Lab
Gene Symbol Ccne1
Ensembl Gene ENSMUSG00000002068
Gene Namecyclin E1
SynonymsCycE1, cyclin E
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7458 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location38097984-38107534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38100671 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 163 (T163A)
Ref Sequence ENSEMBL: ENSMUSP00000103658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108023] [ENSMUST00000124979] [ENSMUST00000130329]
Predicted Effect probably damaging
Transcript: ENSMUST00000108023
AA Change: T163A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103658
Gene: ENSMUSG00000002068
AA Change: T163A

DomainStartEndE-ValueType
CYCLIN 148 233 5.88e-26 SMART
Cyclin_C 242 364 2.36e-13 SMART
low complexity region 385 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124979
Predicted Effect probably damaging
Transcript: ENSMUST00000130329
AA Change: T163A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117662
Gene: ENSMUSG00000002068
AA Change: T163A

DomainStartEndE-ValueType
Pfam:Cyclin_N 113 167 5.4e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2, whose activity is required for cell cycle G1/S transition. This protein accumulates at the G1-S phase boundary and is degraded as cells progress through S phase. Overexpression of this gene has been observed in many tumors, which results in chromosome instability, and thus may contribute to tumorigenesis. This protein was found to associate with, and be involved in, the phosphorylation of NPAT protein (nuclear protein mapped to the ATM locus), which participates in cell-cycle regulated histone gene expression and plays a critical role in promoting cell-cycle progression in the absence of pRB. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene display no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,190,644 V501M probably benign Het
3632451O06Rik T C 14: 49,682,739 Y711C probably damaging Het
Abca13 T C 11: 9,290,777 F880S possibly damaging Het
AI182371 T A 2: 35,086,504 R206S possibly damaging Het
Akr1a1 A T 4: 116,637,817 M286K possibly damaging Het
Aldh8a1 A G 10: 21,395,593 E406G possibly damaging Het
Ambra1 T A 2: 91,917,684 V1255D probably benign Het
Apol7e C T 15: 77,714,404 T23I probably benign Het
Boc T C 16: 44,486,756 E1034G Het
Bricd5 T C 17: 24,474,502 I39T probably damaging Het
Cct7 T C 6: 85,459,996 V72A probably benign Het
Cdh3 A G 8: 106,537,147 D199G probably damaging Het
Clip1 T G 5: 123,640,546 E438A probably damaging Het
Col4a4 T C 1: 82,498,948 I553M unknown Het
Csmd1 A T 8: 15,953,738 N2605K probably damaging Het
Dnajc10 T A 2: 80,324,750 probably null Het
Fbn1 T A 2: 125,319,116 D2168V probably benign Het
G2e3 T A 12: 51,365,507 N443K possibly damaging Het
Gak T C 5: 108,583,074 D822G probably benign Het
Gm9493 A G 19: 23,619,913 I58V probably benign Het
Gpr65 T G 12: 98,276,065 S326A probably damaging Het
Irs2 T C 8: 11,007,739 E231G probably damaging Het
Itga1 T C 13: 114,986,266 D718G probably benign Het
Itih1 T C 14: 30,943,266 M1V probably null Het
Lgr5 A G 10: 115,457,755 probably null Het
Lipn A G 19: 34,071,842 N136S probably benign Het
Lrrc37a G A 11: 103,497,432 T2389I unknown Het
Myo7b G A 18: 31,988,551 A767V possibly damaging Het
Necab1 A T 4: 15,111,244 S61R possibly damaging Het
Olfr1031 A G 2: 85,992,650 T278A probably damaging Het
Phyhip G A 14: 70,461,820 R21H probably damaging Het
Pls1 G A 9: 95,785,507 T116I probably damaging Het
Pnn C A 12: 59,072,414 S594R unknown Het
Psen1 T A 12: 83,714,766 I114N probably damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Slc12a7 T A 13: 73,785,069 V82E probably damaging Het
Slc25a44 A G 3: 88,416,061 I246T probably benign Het
Slc2a13 T A 15: 91,412,187 Y308F probably benign Het
Sntb2 C A 8: 106,936,298 A166E possibly damaging Het
Tas2r135 T A 6: 42,405,947 V140D possibly damaging Het
Tdrd6 T C 17: 43,625,046 T1704A probably benign Het
Txndc12 A G 4: 108,861,409 D159G probably benign Het
Ubash3a T C 17: 31,208,165 L16P probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Vmn2r108 T C 17: 20,472,270 D108G probably benign Het
Vmn2r58 C A 7: 41,837,699 A591S probably benign Het
Wdpcp T C 11: 21,748,919 I566T probably damaging Het
Zfp866 T A 8: 69,765,552 K473* probably null Het
Other mutations in Ccne1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Ccne1 APN 7 38106301 missense probably benign 0.22
IGL02377:Ccne1 APN 7 38098990 critical splice donor site probably null
IGL02800:Ccne1 APN 7 38102799 missense probably damaging 1.00
R1355:Ccne1 UTSW 7 38106322 missense possibly damaging 0.80
R1938:Ccne1 UTSW 7 38106277 critical splice donor site probably null
R4810:Ccne1 UTSW 7 38099593 missense probably damaging 1.00
R4858:Ccne1 UTSW 7 38099319 missense probably damaging 1.00
R4982:Ccne1 UTSW 7 38100571 missense probably damaging 1.00
R6480:Ccne1 UTSW 7 38106854 start gained probably benign
R6981:Ccne1 UTSW 7 38098573 unclassified probably benign
R7165:Ccne1 UTSW 7 38099301 missense probably damaging 1.00
R7398:Ccne1 UTSW 7 38106277 critical splice donor site probably null
R7835:Ccne1 UTSW 7 38102845 missense probably benign 0.03
R7918:Ccne1 UTSW 7 38102845 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATATGACAGTTGTTCATAGGGGC -3'
(R):5'- TCAGTTCCTGGGTCTCACTG -3'

Sequencing Primer
(F):5'- AGTTGTTCATAGGGGCAGAATTTAAG -3'
(R):5'- CTCACTGGGCTGTGCTTAG -3'
Posted On2019-10-07