Incidental Mutation 'R7462:Olfr187'
ID578530
Institutional Source Beutler Lab
Gene Symbol Olfr187
Ensembl Gene ENSMUSG00000043357
Gene Nameolfactory receptor 187
SynonymsGA_x54KRFPKG5P-55265713-55264787, MOR183-8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R7462 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location59035563-59039767 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 59036016 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 240 (C240*)
Ref Sequence ENSEMBL: ENSMUSP00000147035 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000206428
AA Change: C240*
Predicted Effect probably null
Transcript: ENSMUST00000207673
AA Change: C240*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 G C 3: 126,943,034 T3067S unknown Het
Ankrd28 T C 14: 31,778,929 N35S probably benign Het
Bicra A T 7: 15,979,135 S996T possibly damaging Het
Btbd7 T C 12: 102,837,722 E353G possibly damaging Het
Ccdc144b T A 3: 36,025,906 probably null Het
Cdhr2 A T 13: 54,726,739 I875F probably damaging Het
Ceacam5 A T 7: 17,760,839 Y924F probably damaging Het
Clca4b A G 3: 144,922,860 I362T probably benign Het
Dchs2 A G 3: 83,346,155 probably null Het
Dlc1 T A 8: 36,937,964 T224S unknown Het
Dmxl2 T C 9: 54,366,632 probably null Het
Dnajc1 A G 2: 18,308,899 F137S probably damaging Het
E130311K13Rik T C 3: 63,929,301 T24A probably benign Het
Eya1 T C 1: 14,231,414 E317G probably null Het
Fpr-rs6 A G 17: 20,182,223 L292P probably damaging Het
Gca G T 2: 62,672,409 D54Y possibly damaging Het
Gm45861 G A 8: 27,534,489 probably null Het
Gm9573 T C 17: 35,620,676 S873G unknown Het
Gtf2a1l A G 17: 88,694,138 T141A possibly damaging Het
Hgsnat T C 8: 25,957,213 N351S probably benign Het
Htr1f A T 16: 64,926,020 V303E probably damaging Het
Iars2 C A 1: 185,322,866 W302L probably damaging Het
Igkv4-74 T A 6: 69,185,116 Q23L possibly damaging Het
Il18 A T 9: 50,565,373 probably benign Het
Ints4 A G 7: 97,506,128 D329G probably benign Het
Itsn1 T C 16: 91,853,185 F249S possibly damaging Het
Ktn1 A G 14: 47,694,632 E672G probably null Het
Lhx6 A G 2: 36,084,071 I359T possibly damaging Het
Lrp1b T C 2: 41,113,029 E2030G Het
Macf1 T A 4: 123,492,763 K1114N probably damaging Het
Mbd5 A G 2: 49,257,880 M701V possibly damaging Het
Mcemp1 A T 8: 3,667,065 M69L probably benign Het
Mfsd4b2 T A 10: 39,921,881 K159N probably benign Het
Mroh2b T A 15: 4,908,627 D243E probably damaging Het
Mug1 A T 6: 121,875,440 Q829L probably benign Het
Nav3 A T 10: 109,823,578 V726E probably damaging Het
Nfib T C 4: 82,353,589 Q247R probably benign Het
Npbwr1 T C 1: 5,916,932 N121S probably damaging Het
Olfr378 T C 11: 73,425,470 D171G probably benign Het
Olfr691 T A 7: 105,337,500 D72V probably damaging Het
Pkd1l3 A G 8: 109,628,777 S726G probably benign Het
Ppip5k1 A T 2: 121,336,751 V847D probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Ripor2 G A 13: 24,696,307 V385M unknown Het
Rufy1 C T 11: 50,407,828 V379M possibly damaging Het
S100a5 A G 3: 90,609,900 K26R probably damaging Het
Sin3a T C 9: 57,095,525 S234P probably benign Het
Sirt7 G A 11: 120,620,792 T225I probably benign Het
Slc17a2 A T 13: 23,822,418 T476S probably damaging Het
Slc38a6 T A 12: 73,350,577 M331K probably benign Het
Spam1 T C 6: 24,796,908 I286T probably damaging Het
Syne1 T A 10: 5,052,793 I214F possibly damaging Het
Tmtc1 A G 6: 148,325,145 L427P probably damaging Het
Tpbg G A 9: 85,844,850 A291T possibly damaging Het
Zfp40 A G 17: 23,178,388 F45S possibly damaging Het
Zfp451 C T 1: 33,777,013 V619M probably damaging Het
Zim1 A G 7: 6,677,812 L284P probably damaging Het
Zkscan4 A G 13: 21,483,874 E165G probably benign Het
Zmynd11 T A 13: 9,698,684 N154Y probably benign Het
Zscan12 A T 13: 21,369,287 H427L possibly damaging Het
Other mutations in Olfr187
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Olfr187 APN 16 59035906 missense probably damaging 1.00
R0218:Olfr187 UTSW 16 59036093 missense probably benign 0.00
R1023:Olfr187 UTSW 16 59035815 missense probably benign 0.00
R1086:Olfr187 UTSW 16 59036263 missense probably damaging 1.00
R1472:Olfr187 UTSW 16 59036557 missense probably damaging 1.00
R4710:Olfr187 UTSW 16 59036275 missense possibly damaging 0.94
R4738:Olfr187 UTSW 16 59036195 missense probably benign 0.00
R5265:Olfr187 UTSW 16 59036143 missense possibly damaging 0.94
R6053:Olfr187 UTSW 16 59035988 missense probably damaging 1.00
R6704:Olfr187 UTSW 16 59035862 missense probably damaging 1.00
R6854:Olfr187 UTSW 16 59036065 missense possibly damaging 0.75
R7178:Olfr187 UTSW 16 59035933 missense probably benign 0.06
R7198:Olfr187 UTSW 16 59036093 missense probably benign 0.00
R7404:Olfr187 UTSW 16 59036240 missense possibly damaging 0.81
R7938:Olfr187 UTSW 16 59035962 nonsense probably null
R8785:Olfr187 UTSW 16 59036167 missense probably damaging 1.00
R8790:Olfr187 UTSW 16 59036217 missense possibly damaging 0.96
R8912:Olfr187 UTSW 16 59035900 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CCCAAATGTAACAGAGAGTTGC -3'
(R):5'- CTACCCAGTAGTTATGACCAATGGTC -3'

Sequencing Primer
(F):5'- TTGCCAGTGAATCTATAACTTGC -3'
(R):5'- GCTGGAATTATTCATGCTTTGATTC -3'
Posted On2019-10-07