Incidental Mutation 'R7488:2700049A03Rik'
ID 580360
Institutional Source Beutler Lab
Gene Symbol 2700049A03Rik
Ensembl Gene ENSMUSG00000034601
Gene Name RIKEN cDNA 2700049A03 gene
Synonyms talpid3, Ta3
MMRRC Submission 045562-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7488 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 71183622-71290077 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 71197179 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 251 (F251I)
Ref Sequence ENSEMBL: ENSMUSP00000118956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045907] [ENSMUST00000149564]
AlphaFold E9PV87
Predicted Effect possibly damaging
Transcript: ENSMUST00000045907
AA Change: F251I

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044701
Gene: ENSMUSG00000034601
AA Change: F251I

DomainStartEndE-ValueType
Pfam:TALPID3 116 1351 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134748
Predicted Effect possibly damaging
Transcript: ENSMUST00000149564
AA Change: F251I

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118956
Gene: ENSMUSG00000034601
AA Change: F251I

DomainStartEndE-ValueType
Pfam:TALPID3 116 1349 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved centrosomal protein that functions in ciliogenesis and responds to hedgehog signaling. Mutations in this gene causes Joubert syndrome 23. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele die during organogenesis, lack cilia, and show randomized L-R patterning, face and neural tube defects, pericardial edema and hemorrhages. Mouse embryonic fibroblasts homozygous for a different null allele lack cilia and asymmetrical centriolar localization. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,108,146 (GRCm39) G717D probably benign Het
Abcc1 G A 16: 14,207,763 (GRCm39) W47* probably null Het
Ahnak2 A G 12: 112,748,641 (GRCm39) I402T Het
Ankfy1 G A 11: 72,650,769 (GRCm39) R984Q probably benign Het
Apaf1 A G 10: 90,890,242 (GRCm39) I598T probably benign Het
Apobec1 G T 6: 122,558,521 (GRCm39) P78Q possibly damaging Het
Asap1 A T 15: 63,991,974 (GRCm39) I737N probably benign Het
Aste1 T A 9: 105,279,904 (GRCm39) probably null Het
Bcr A C 10: 74,996,162 (GRCm39) D902A possibly damaging Het
Bicra T C 7: 15,723,367 (GRCm39) probably null Het
Ccdc27 T C 4: 154,117,424 (GRCm39) T508A probably benign Het
Ccz1 T A 5: 143,928,401 (GRCm39) N383I probably damaging Het
Cdh24 T C 14: 54,869,637 (GRCm39) D760G possibly damaging Het
Cdhr2 T C 13: 54,865,728 (GRCm39) I242T probably benign Het
Cdk4 T A 10: 126,900,106 (GRCm39) M1K probably null Het
Cfap96 A G 8: 46,415,331 (GRCm39) V225A probably benign Het
Cntn5 A T 9: 9,970,570 (GRCm39) S302T probably damaging Het
Col25a1 G T 3: 130,378,350 (GRCm39) G601V probably damaging Het
Cpb1 A G 3: 20,324,488 (GRCm39) L62P possibly damaging Het
Cpne1 T C 2: 155,919,857 (GRCm39) T264A probably benign Het
Cpvl T A 6: 53,924,727 (GRCm39) N198Y probably damaging Het
Cyp2u1 A C 3: 131,091,596 (GRCm39) L308R probably damaging Het
Ddx54 G T 5: 120,762,789 (GRCm39) V637L probably benign Het
Dglucy C A 12: 100,823,310 (GRCm39) P472T possibly damaging Het
Dync2h1 A G 9: 7,124,855 (GRCm39) Y2006H probably benign Het
Eif5b T C 1: 38,089,387 (GRCm39) M1121T possibly damaging Het
Emsy A G 7: 98,264,762 (GRCm39) V545A possibly damaging Het
Ezh1 G A 11: 101,091,726 (GRCm39) L480F possibly damaging Het
Fbln2 T A 6: 91,242,845 (GRCm39) probably null Het
Gja10 T A 4: 32,602,058 (GRCm39) K109* probably null Het
Gm28042 A G 2: 119,870,438 (GRCm39) N762S probably benign Het
Gnb1l C A 16: 18,359,220 (GRCm39) P7Q possibly damaging Het
Grem2 A T 1: 174,664,685 (GRCm39) S55T probably damaging Het
Gsn A T 2: 35,186,433 (GRCm39) N393I possibly damaging Het
H6pd T A 4: 150,067,093 (GRCm39) Q439L probably benign Het
Hmcn2 G A 2: 31,310,842 (GRCm39) G3362E probably damaging Het
Ighv11-2 T C 12: 114,011,978 (GRCm39) Y79C probably damaging Het
Ikzf2 T A 1: 69,578,544 (GRCm39) N322Y probably benign Het
Il25 A G 14: 55,170,459 (GRCm39) I11V probably benign Het
Jak2 C T 19: 29,275,783 (GRCm39) T741I probably damaging Het
Kdm3b T C 18: 34,957,934 (GRCm39) S1300P probably damaging Het
Ldb3 T A 14: 34,289,402 (GRCm39) Q268L probably damaging Het
Lrrc23 T A 6: 124,756,075 (GRCm39) D6V unknown Het
Megf10 A G 18: 57,324,187 (GRCm39) Y76C probably damaging Het
Neb A T 2: 52,110,233 (GRCm39) M205K probably benign Het
Or12e8 T C 2: 87,188,597 (GRCm39) S270P probably damaging Het
Or6c2b G T 10: 128,947,605 (GRCm39) Q230K probably benign Het
Or8a1 A G 9: 37,641,983 (GRCm39) S99P probably damaging Het
Pcnx3 G A 19: 5,717,487 (GRCm39) R1541W possibly damaging Het
Pdgfd A G 9: 6,359,739 (GRCm39) Y270C probably damaging Het
Pds5b A T 5: 150,646,802 (GRCm39) D197V probably damaging Het
Pknox2 A G 9: 36,866,127 (GRCm39) M30T probably benign Het
Plekhg1 A T 10: 3,907,491 (GRCm39) S858C Het
Por A T 5: 135,762,498 (GRCm39) E400D probably benign Het
Pou2af2 C A 9: 51,201,360 (GRCm39) R232L probably damaging Het
Psip1 A G 4: 83,391,275 (GRCm39) probably null Het
Retreg1 G T 15: 25,889,628 (GRCm39) V111F Het
Rock1 G A 18: 10,122,762 (GRCm39) A353V probably damaging Het
Rpl6 C G 5: 121,346,591 (GRCm39) R231G probably benign Het
Scn7a C T 2: 66,587,574 (GRCm39) R43H probably benign Het
Scnn1g T A 7: 121,362,657 (GRCm39) N488K probably benign Het
Slc24a1 A G 9: 64,831,764 (GRCm39) V1111A probably benign Het
Snapc1 C T 12: 74,029,285 (GRCm39) S356L probably benign Het
Spata31e2 T C 1: 26,723,039 (GRCm39) T714A possibly damaging Het
Ssbp2 T A 13: 91,823,209 (GRCm39) N201K probably damaging Het
Tfdp2 A G 9: 96,179,695 (GRCm39) N43D probably damaging Het
Tmprss11d A G 5: 86,474,309 (GRCm39) I216T probably damaging Het
Tmprss4 A G 9: 45,086,853 (GRCm39) S303P probably benign Het
Tnpo2 A G 8: 85,781,663 (GRCm39) E815G probably benign Het
Trav6-1 A C 14: 52,875,972 (GRCm39) M1L possibly damaging Het
Trpm3 T C 19: 22,955,937 (GRCm39) V1133A probably damaging Het
Trpv1 C T 11: 73,129,355 (GRCm39) P91S probably benign Het
Trpv2 T C 11: 62,480,576 (GRCm39) Y338H probably damaging Het
Txnip T C 3: 96,467,539 (GRCm39) M336T probably benign Het
Vmn1r61 A T 7: 5,613,767 (GRCm39) H182Q possibly damaging Het
Vmn2r105 A G 17: 20,429,045 (GRCm39) V677A probably damaging Het
Wwp1 G T 4: 19,627,660 (GRCm39) T745K probably damaging Het
Xkr5 C A 8: 18,983,608 (GRCm39) E645* probably null Het
Zfp451 C T 1: 33,818,221 (GRCm39) R303H probably benign Het
Zyg11b T C 4: 108,123,655 (GRCm39) H104R possibly damaging Het
Other mutations in 2700049A03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:2700049A03Rik APN 12 71,213,893 (GRCm39) missense probably benign 0.00
IGL01107:2700049A03Rik APN 12 71,241,242 (GRCm39) critical splice donor site probably null
IGL01404:2700049A03Rik APN 12 71,211,152 (GRCm39) splice site probably null
IGL01835:2700049A03Rik APN 12 71,213,957 (GRCm39) missense probably benign 0.00
IGL01835:2700049A03Rik APN 12 71,213,955 (GRCm39) nonsense probably null
IGL02122:2700049A03Rik APN 12 71,217,299 (GRCm39) missense possibly damaging 0.93
IGL02140:2700049A03Rik APN 12 71,195,034 (GRCm39) missense probably benign 0.06
IGL02385:2700049A03Rik APN 12 71,201,630 (GRCm39) missense probably damaging 0.98
IGL03181:2700049A03Rik APN 12 71,240,147 (GRCm39) missense possibly damaging 0.51
IGL03253:2700049A03Rik APN 12 71,187,657 (GRCm39) missense probably benign 0.33
IGL03278:2700049A03Rik APN 12 71,205,599 (GRCm39) splice site probably benign
G4846:2700049A03Rik UTSW 12 71,184,683 (GRCm39) missense probably benign
PIT1430001:2700049A03Rik UTSW 12 71,207,160 (GRCm39) missense possibly damaging 0.71
PIT4519001:2700049A03Rik UTSW 12 71,217,440 (GRCm39) missense probably benign 0.05
R0108:2700049A03Rik UTSW 12 71,224,692 (GRCm39) missense probably benign 0.14
R0165:2700049A03Rik UTSW 12 71,213,924 (GRCm39) missense possibly damaging 0.52
R0211:2700049A03Rik UTSW 12 71,262,870 (GRCm39) missense possibly damaging 0.96
R0211:2700049A03Rik UTSW 12 71,262,870 (GRCm39) missense possibly damaging 0.96
R0220:2700049A03Rik UTSW 12 71,195,194 (GRCm39) critical splice donor site probably null
R0352:2700049A03Rik UTSW 12 71,184,804 (GRCm39) missense possibly damaging 0.96
R0468:2700049A03Rik UTSW 12 71,240,084 (GRCm39) missense possibly damaging 0.71
R0508:2700049A03Rik UTSW 12 71,211,162 (GRCm39) missense probably damaging 0.98
R0673:2700049A03Rik UTSW 12 71,224,642 (GRCm39) missense probably damaging 0.97
R0840:2700049A03Rik UTSW 12 71,205,657 (GRCm39) missense probably benign 0.16
R0893:2700049A03Rik UTSW 12 71,266,082 (GRCm39) splice site probably benign
R1244:2700049A03Rik UTSW 12 71,262,918 (GRCm39) missense probably benign 0.25
R1432:2700049A03Rik UTSW 12 71,217,361 (GRCm39) splice site probably null
R1599:2700049A03Rik UTSW 12 71,197,033 (GRCm39) missense probably damaging 0.98
R1732:2700049A03Rik UTSW 12 71,265,995 (GRCm39) missense probably benign 0.18
R1820:2700049A03Rik UTSW 12 71,197,018 (GRCm39) missense possibly damaging 0.51
R1939:2700049A03Rik UTSW 12 71,207,186 (GRCm39) splice site probably null
R1998:2700049A03Rik UTSW 12 71,235,393 (GRCm39) missense possibly damaging 0.86
R2337:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2337:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2340:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2340:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2382:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2382:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2384:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2384:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2445:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2445:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2449:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2449:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2512:2700049A03Rik UTSW 12 71,219,945 (GRCm39) missense possibly damaging 0.71
R2872:2700049A03Rik UTSW 12 71,201,530 (GRCm39) splice site probably benign
R3236:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3236:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3237:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3237:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3734:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3734:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3808:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3808:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3809:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3809:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3944:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3944:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3959:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3959:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3960:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3960:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4593:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4593:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4595:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4595:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4596:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4596:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4600:2700049A03Rik UTSW 12 71,195,037 (GRCm39) missense possibly damaging 0.67
R4649:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4649:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4651:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4651:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4652:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4652:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4714:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4714:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4735:2700049A03Rik UTSW 12 71,262,897 (GRCm39) missense possibly damaging 0.88
R4810:2700049A03Rik UTSW 12 71,236,216 (GRCm39) missense possibly damaging 0.51
R4852:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4852:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4854:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4854:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4855:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4855:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4884:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4884:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4893:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4893:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4905:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4905:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4915:2700049A03Rik UTSW 12 71,236,420 (GRCm39) missense possibly damaging 0.92
R4919:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4919:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4959:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4959:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4989:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4989:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5011:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5011:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5012:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5012:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5118:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5118:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5146:2700049A03Rik UTSW 12 71,289,799 (GRCm39) missense possibly damaging 0.85
R5163:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5163:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5188:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5188:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5189:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5189:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5189:2700049A03Rik UTSW 12 71,240,123 (GRCm39) missense possibly damaging 0.93
R5190:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5190:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5290:2700049A03Rik UTSW 12 71,235,565 (GRCm39) missense probably benign 0.00
R5344:2700049A03Rik UTSW 12 71,289,801 (GRCm39) missense probably benign
R5502:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5502:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5503:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5503:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5619:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5619:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5667:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5667:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5669:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5669:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5671:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5671:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5725:2700049A03Rik UTSW 12 71,240,093 (GRCm39) missense probably benign 0.05
R5956:2700049A03Rik UTSW 12 71,203,893 (GRCm39) missense possibly damaging 0.86
R6051:2700049A03Rik UTSW 12 71,231,304 (GRCm39) missense possibly damaging 0.84
R6148:2700049A03Rik UTSW 12 71,234,200 (GRCm39) missense possibly damaging 0.71
R6158:2700049A03Rik UTSW 12 71,217,410 (GRCm39) missense possibly damaging 0.51
R6916:2700049A03Rik UTSW 12 71,211,318 (GRCm39) missense possibly damaging 0.86
R7129:2700049A03Rik UTSW 12 71,263,004 (GRCm39) splice site probably null
R7168:2700049A03Rik UTSW 12 71,262,831 (GRCm39) missense probably damaging 0.98
R7193:2700049A03Rik UTSW 12 71,265,963 (GRCm39) critical splice acceptor site probably null
R7200:2700049A03Rik UTSW 12 71,187,680 (GRCm39) missense probably damaging 0.96
R7359:2700049A03Rik UTSW 12 71,236,348 (GRCm39) missense possibly damaging 0.51
R7755:2700049A03Rik UTSW 12 71,236,187 (GRCm39) missense probably benign 0.02
R7757:2700049A03Rik UTSW 12 71,236,187 (GRCm39) missense probably benign 0.02
R7922:2700049A03Rik UTSW 12 71,211,180 (GRCm39) missense possibly damaging 0.83
R7966:2700049A03Rik UTSW 12 71,219,903 (GRCm39) missense probably benign 0.00
R8082:2700049A03Rik UTSW 12 71,188,895 (GRCm39) critical splice donor site probably null
R8311:2700049A03Rik UTSW 12 71,184,815 (GRCm39) unclassified probably benign
R8408:2700049A03Rik UTSW 12 71,236,356 (GRCm39) missense possibly damaging 0.71
R8852:2700049A03Rik UTSW 12 71,231,197 (GRCm39) missense possibly damaging 0.93
R8860:2700049A03Rik UTSW 12 71,231,197 (GRCm39) missense possibly damaging 0.93
R9039:2700049A03Rik UTSW 12 71,213,849 (GRCm39) missense possibly damaging 0.51
R9281:2700049A03Rik UTSW 12 71,205,687 (GRCm39) missense possibly damaging 0.51
R9308:2700049A03Rik UTSW 12 71,231,233 (GRCm39) missense probably benign 0.23
R9385:2700049A03Rik UTSW 12 71,207,966 (GRCm39) missense possibly damaging 0.52
R9412:2700049A03Rik UTSW 12 71,235,457 (GRCm39) missense possibly damaging 0.71
R9643:2700049A03Rik UTSW 12 71,211,189 (GRCm39) missense possibly damaging 0.92
R9676:2700049A03Rik UTSW 12 71,207,905 (GRCm39) missense possibly damaging 0.86
R9776:2700049A03Rik UTSW 12 71,235,448 (GRCm39) missense possibly damaging 0.71
R9789:2700049A03Rik UTSW 12 71,231,357 (GRCm39) missense probably benign
Z1177:2700049A03Rik UTSW 12 71,211,258 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGAGCACACCTTTAATGTC -3'
(R):5'- TAAGGAGAGGTCTCACAGCACC -3'

Sequencing Primer
(F):5'- GAGCACACCTTTAATGTCTTTCTACG -3'
(R):5'- TCTACACAGCATAAAGAATAATGAGC -3'
Posted On 2019-10-07