Incidental Mutation 'R1432:2700049A03Rik'
ID162333
Institutional Source Beutler Lab
Gene Symbol 2700049A03Rik
Ensembl Gene ENSMUSG00000034601
Gene NameRIKEN cDNA 2700049A03 gene
Synonymstalpid3
MMRRC Submission 039487-MU
Accession Numbers

Genbank: NM_001163378, NM_029818

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1432 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location71136848-71243303 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 71170587 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000045907] [ENSMUST00000149564]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045907
AA Change: T777A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044701
Gene: ENSMUSG00000034601
AA Change: T777A

DomainStartEndE-ValueType
Pfam:TALPID3 116 1351 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000129376
Predicted Effect probably benign
Transcript: ENSMUST00000149564
AA Change: T777A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118956
Gene: ENSMUSG00000034601
AA Change: T777A

DomainStartEndE-ValueType
Pfam:TALPID3 116 1349 N/A PFAM
Meta Mutation Damage Score 0.1041 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved centrosomal protein that functions in ciliogenesis and responds to hedgehog signaling. Mutations in this gene causes Joubert syndrome 23. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele die during organogenesis, lack cilia, and show randomized L-R patterning, face and neural tube defects, pericardial edema and hemorrhages. Mouse embryonic fibroblasts homozygous for a different null allele lack cilia and asymmetrical centriolar localization. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,860 L117Q probably damaging Het
Abcb1b A G 5: 8,837,771 K886E possibly damaging Het
Acaa2 A T 18: 74,787,127 I9F probably damaging Het
Acap2 A T 16: 31,111,083 S386T probably damaging Het
Acsm2 A T 7: 119,573,575 I138F possibly damaging Het
Agl T C 3: 116,746,693 Y1424C probably damaging Het
Apc2 T C 10: 80,312,349 V1079A probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Armc8 C T 9: 99,523,132 probably benign Het
BC005561 T C 5: 104,518,104 F164S probably damaging Het
Catsperb A G 12: 101,622,217 Y953C probably damaging Het
Cdk13 G A 13: 17,718,416 A720V probably damaging Het
Chka T C 19: 3,874,809 probably benign Het
Clcc1 T C 3: 108,668,102 I165T probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Dip2c C A 13: 9,553,304 P297Q probably damaging Het
Dnah17 A T 11: 118,023,327 W4429R probably damaging Het
Doxl2 T A 6: 48,975,654 F171Y probably damaging Het
Dram2 T C 3: 106,570,766 V138A possibly damaging Het
Dus4l T C 12: 31,648,771 N78S probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Ebf1 T C 11: 45,004,706 probably benign Het
Epm2a T A 10: 11,390,843 Y111N probably damaging Het
Gm773 T C X: 56,202,017 T52A probably benign Het
Gpam C A 19: 55,079,261 M483I probably damaging Het
Gpr12 T C 5: 146,583,425 H229R probably damaging Het
Gpr149 T C 3: 62,531,018 T573A probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hells T A 19: 38,957,184 probably null Het
Herc1 T A 9: 66,465,469 N3102K probably benign Het
Herc3 A T 6: 58,916,842 T968S possibly damaging Het
Ift88 A G 14: 57,437,279 Y69C probably benign Het
Incenp G A 19: 9,885,526 T388M unknown Het
Jrkl A G 9: 13,245,332 F108S probably benign Het
Khdc1a A G 1: 21,350,318 E54G possibly damaging Het
Kif6 T A 17: 49,620,700 F58L probably damaging Het
Klk14 T C 7: 43,694,918 S218P probably damaging Het
Kmt2e T C 5: 23,450,321 M19T probably benign Het
Llgl1 G T 11: 60,708,554 G454C probably damaging Het
Lyrm4 A G 13: 36,092,915 V33A probably benign Het
Mcam C T 9: 44,141,291 R606C probably damaging Het
Mgam T A 6: 40,756,367 M692K probably damaging Het
Mkl2 A G 16: 13,401,002 N504S probably benign Het
Mmp28 C T 11: 83,442,939 R392H probably damaging Het
Mpdz G A 4: 81,292,551 T1699M probably damaging Het
Mrps11 T C 7: 78,783,562 probably benign Het
Msmo1 A G 8: 64,727,616 probably benign Het
Mst1 A G 9: 108,084,204 E571G probably benign Het
Myh14 T C 7: 44,616,299 E1585G probably damaging Het
Myrfl A G 10: 116,777,427 C824R probably damaging Het
Ncapd3 C T 9: 27,069,872 probably benign Het
Nlrp4a G GGTTCTTC 7: 26,464,197 probably null Het
Nos1 C T 5: 117,949,619 probably benign Het
Notch3 T C 17: 32,164,224 S47G probably benign Het
Npsr1 A G 9: 24,310,075 Y122C probably damaging Het
Olfr1335 T C 4: 118,809,238 M209V probably benign Het
Olfr339 C T 2: 36,421,643 L82F probably damaging Het
Olfr420 T A 1: 174,158,917 V48E possibly damaging Het
Olfr76 G T 19: 12,120,239 R158S possibly damaging Het
Olfr786 C T 10: 129,436,938 T42I probably damaging Het
Olfr877 T A 9: 37,855,252 L145M possibly damaging Het
Otog G T 7: 46,300,583 V2490F probably damaging Het
Pibf1 T C 14: 99,112,989 V191A probably benign Het
Pip A G 6: 41,849,918 M66V probably benign Het
Plxna2 C T 1: 194,767,463 R830C probably benign Het
Prkca A T 11: 107,939,520 V248E probably benign Het
Prmt7 T A 8: 106,237,284 L253* probably null Het
Prrc2a G T 17: 35,153,912 probably benign Het
Rasgrf1 A G 9: 90,012,800 D1091G probably benign Het
Rbm7 C A 9: 48,489,945 G161V probably benign Het
Scn1a A T 2: 66,322,429 I736N probably damaging Het
Skint6 A G 4: 112,869,524 probably benign Het
Slc22a2 C T 17: 12,584,308 H10Y possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stam2 A G 2: 52,714,809 probably benign Het
Stk40 T C 4: 126,136,833 L282P probably damaging Het
Tas2r110 A G 6: 132,868,368 N121D probably damaging Het
Tbc1d32 A G 10: 56,017,662 Y1272H probably damaging Het
Tmem131l T C 3: 83,928,714 D696G probably damaging Het
Trdmt1 T C 2: 13,519,846 Y266C probably damaging Het
Trim5 G T 7: 104,279,519 H72N probably benign Het
Trim5 A C 7: 104,279,521 L71R probably benign Het
Twf2 T A 9: 106,214,813 probably benign Het
Ubap2l T C 3: 90,019,328 T580A probably benign Het
Ugt1a10 C T 1: 88,216,260 R201C probably damaging Het
Unc5a A G 13: 55,004,472 probably benign Het
Vmn2r85 T C 10: 130,425,286 N394S possibly damaging Het
Wrn A T 8: 33,319,141 probably benign Het
Other mutations in 2700049A03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:2700049A03Rik APN 12 71167119 missense probably benign 0.00
IGL01107:2700049A03Rik APN 12 71194468 critical splice donor site probably null
IGL01404:2700049A03Rik APN 12 71164378 splice site probably null
IGL01835:2700049A03Rik APN 12 71167181 nonsense probably null
IGL01835:2700049A03Rik APN 12 71167183 missense probably benign 0.00
IGL02122:2700049A03Rik APN 12 71170525 missense possibly damaging 0.93
IGL02140:2700049A03Rik APN 12 71148260 missense probably benign 0.06
IGL02385:2700049A03Rik APN 12 71154856 missense probably damaging 0.98
IGL03181:2700049A03Rik APN 12 71193373 missense possibly damaging 0.51
IGL03253:2700049A03Rik APN 12 71140883 missense probably benign 0.33
IGL03278:2700049A03Rik APN 12 71158825 splice site probably benign
G4846:2700049A03Rik UTSW 12 71137909 missense probably benign
PIT1430001:2700049A03Rik UTSW 12 71160386 missense possibly damaging 0.71
PIT4519001:2700049A03Rik UTSW 12 71170666 missense probably benign 0.05
R0108:2700049A03Rik UTSW 12 71177918 missense probably benign 0.14
R0165:2700049A03Rik UTSW 12 71167150 missense possibly damaging 0.52
R0211:2700049A03Rik UTSW 12 71216096 missense possibly damaging 0.96
R0211:2700049A03Rik UTSW 12 71216096 missense possibly damaging 0.96
R0220:2700049A03Rik UTSW 12 71148420 critical splice donor site probably null
R0352:2700049A03Rik UTSW 12 71138030 missense possibly damaging 0.96
R0468:2700049A03Rik UTSW 12 71193310 missense possibly damaging 0.71
R0508:2700049A03Rik UTSW 12 71164388 missense probably damaging 0.98
R0673:2700049A03Rik UTSW 12 71177868 missense probably damaging 0.97
R0840:2700049A03Rik UTSW 12 71158883 missense probably benign 0.16
R0893:2700049A03Rik UTSW 12 71219308 splice site probably benign
R1244:2700049A03Rik UTSW 12 71216144 missense probably benign 0.25
R1599:2700049A03Rik UTSW 12 71150259 missense probably damaging 0.98
R1732:2700049A03Rik UTSW 12 71219221 missense probably benign 0.18
R1820:2700049A03Rik UTSW 12 71150244 missense possibly damaging 0.51
R1939:2700049A03Rik UTSW 12 71160412 splice site probably null
R1998:2700049A03Rik UTSW 12 71188619 missense possibly damaging 0.86
R2337:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2337:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2340:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2340:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2382:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2382:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2384:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2384:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2445:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2445:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2449:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2449:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2512:2700049A03Rik UTSW 12 71173171 missense possibly damaging 0.71
R2872:2700049A03Rik UTSW 12 71154756 splice site probably benign
R3236:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3236:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3237:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3237:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3734:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3734:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3808:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3808:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3809:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3809:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3944:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3944:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3959:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3959:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3960:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3960:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4593:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4593:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4595:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4595:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4596:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4596:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4600:2700049A03Rik UTSW 12 71148263 missense possibly damaging 0.67
R4649:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4649:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4651:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4651:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4652:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4652:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4714:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4714:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4735:2700049A03Rik UTSW 12 71216123 missense possibly damaging 0.88
R4810:2700049A03Rik UTSW 12 71189442 missense possibly damaging 0.51
R4852:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4852:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4854:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4854:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4855:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4855:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4884:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4884:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4893:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4893:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4905:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4905:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4915:2700049A03Rik UTSW 12 71189646 missense possibly damaging 0.92
R4919:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4919:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4959:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4959:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4989:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4989:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5011:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5011:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5012:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5012:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5118:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5118:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5146:2700049A03Rik UTSW 12 71243025 missense possibly damaging 0.85
R5163:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5163:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5188:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5188:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5189:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5189:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5189:2700049A03Rik UTSW 12 71193349 missense possibly damaging 0.93
R5190:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5190:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5290:2700049A03Rik UTSW 12 71188791 missense probably benign 0.00
R5344:2700049A03Rik UTSW 12 71243027 missense probably benign
R5502:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5502:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5503:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5503:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5619:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5619:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5667:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5667:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5669:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5669:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5671:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5671:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5725:2700049A03Rik UTSW 12 71193319 missense probably benign 0.05
R5956:2700049A03Rik UTSW 12 71157119 missense possibly damaging 0.86
R6051:2700049A03Rik UTSW 12 71184530 missense possibly damaging 0.84
R6148:2700049A03Rik UTSW 12 71187426 missense possibly damaging 0.71
R6158:2700049A03Rik UTSW 12 71170636 missense possibly damaging 0.51
R6916:2700049A03Rik UTSW 12 71164544 missense possibly damaging 0.86
R7129:2700049A03Rik UTSW 12 71216230 intron probably null
R7168:2700049A03Rik UTSW 12 71216057 missense probably damaging 0.98
R7193:2700049A03Rik UTSW 12 71219189 critical splice acceptor site probably null
R7200:2700049A03Rik UTSW 12 71140906 missense probably damaging 0.96
R7359:2700049A03Rik UTSW 12 71189574 missense possibly damaging 0.51
R7488:2700049A03Rik UTSW 12 71150405 missense possibly damaging 0.67
R7755:2700049A03Rik UTSW 12 71189413 missense probably benign 0.02
R7757:2700049A03Rik UTSW 12 71189413 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCTCTTTCCTTTTGTGAGCAAGACCAG -3'
(R):5'- TGCAGAGCAAGCATAGCGACAC -3'

Sequencing Primer
(F):5'- GTCACAAAGATCCAGGCAGTC -3'
(R):5'- AAGCAATGAACTGTGGGTTCTC -3'
Posted On2014-03-14