Mutagenetix > Incidental Mutations

Incidental Mutation 'R7533:Alpk2'

583434

Institutional Source

Beutler Lab

Gene Symbol

Alpk2

Ensembl Gene

ENSMUSG00000032845

Gene Name

alpha-kinase 2

Synonyms

Hak

MMRRC Submission

Accession Numbers

Genbank: NM_001037294

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7533 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

65265529-65393888 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 65304603 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1240 (S1240T)

Ref Sequence

ENSEMBL: ENSMUSP00000114658 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035548] [ENSMUST00000141250]

AlphaFold

Q91ZB0

Predicted Effect

probably damaging
Transcript: ENSMUST00000035548
AA Change: S1707T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000048752
Gene: ENSMUSG00000032845
AA Change: S1707T

Domain	Start	End	E-Value	Type
IGc2	24	94	9.34e-4	SMART
low complexity region	196	209	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	1025	1037	N/A	INTRINSIC
low complexity region	1337	1353	N/A	INTRINSIC
IG	1766	1849	2.27e-2	SMART
Alpha_kinase	1879	2098	3.72e-79	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000141250
AA Change: S1240T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000114658
Gene: ENSMUSG00000032845
AA Change: S1240T

Domain	Start	End	E-Value	Type
low complexity region	255	267	N/A	INTRINSIC
low complexity region	558	570	N/A	INTRINSIC
low complexity region	870	886	N/A	INTRINSIC
IG	1299	1382	2.27e-2	SMART
Alpha_kinase	1412	1603	2.45e-56	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (36/36)

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agr2	T	C	12: 35,996,129		probably null	Het
AI314180	T	C	4: 58,809,411	I1654M	probably benign	Het
Atp8b2	G	A	3: 89,945,524	L144F		Het
Cck	T	C	9: 121,490,135	D94G	probably damaging	Het
Ccser1	A	T	6: 61,638,490	T659S	probably benign	Het
Cfap74	C	A	4: 155,415,743	D15E		Het
Commd5	G	A	15: 76,900,576	A58T	probably benign	Het
Dctn2	A	G	10: 127,267,478	D34G	possibly damaging	Het
Epha6	T	C	16: 60,205,562	T506A	probably damaging	Het
Fat4	A	C	3: 39,007,257	I4330L	probably benign	Het
Fcho2	G	T	13: 98,784,799	Q193K	probably benign	Het
Hace1	A	T	10: 45,711,474	I890L	probably benign	Het
Igsf11	T	G	16: 39,008,874	N102K	probably benign	Het
Il7r	G	A	15: 9,507,961	S425L	probably benign	Het
Itga3	G	T	11: 95,046,518	Q1011K	probably benign	Het
Kif3c	T	A	12: 3,366,510	I177N	probably damaging	Het
Neb	G	A	2: 52,224,566	A1048V		Het
Neu4	C	T	1: 94,022,400	T27M	probably benign	Het
Olfr549	T	C	7: 102,554,511	S76P	probably damaging	Het
P4htm	T	C	9: 108,596,937	H134R	probably benign	Het
Padi6	T	C	4: 140,731,195	D462G	probably damaging	Het
Pi4ka	T	C	16: 17,297,661	D1375G		Het
Ptgr1	C	T	4: 58,971,011	R247H	possibly damaging	Het
Rad50	T	C	11: 53,698,919	N152D	probably damaging	Het
Serpina1c	T	A	12: 103,897,307	K211N	probably damaging	Het
Sgsh	T	C	11: 119,347,870	E256G	probably damaging	Het
Tnrc6b	T	C	15: 80,927,741		probably null	Het
Ube2cbp	A	G	9: 86,422,937	F284S	probably damaging	Het
Usp13	A	G	3: 32,918,942	D757G	probably damaging	Het
Vmn1r173	C	T	7: 23,702,646	A102V	probably benign	Het
Vmn2r29	G	T	7: 7,241,657	A406D	probably damaging	Het
Wdfy3	G	A	5: 101,882,488	R2385C	probably benign	Het
Zfp112	A	T	7: 24,125,327	K244M	possibly damaging	Het
Zfp61	T	C	7: 24,291,079	Q549R	probably benign	Het

Other mutations in Alpk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Alpk2	APN	18	65305823	missense	probably benign	0.27
IGL00478:Alpk2	APN	18	65307226	nonsense	probably null
IGL00898:Alpk2	APN	18	65350573	missense	probably benign	0.29
IGL00978:Alpk2	APN	18	65291534	splice site	probably benign
IGL01093:Alpk2	APN	18	65349329	missense	probably damaging	0.98
IGL01094:Alpk2	APN	18	65306602	missense	probably damaging	0.96
IGL01109:Alpk2	APN	18	65307140	missense	probably benign	0.09
IGL01370:Alpk2	APN	18	65350591	missense	possibly damaging	0.56
IGL01393:Alpk2	APN	18	65307708	missense	possibly damaging	0.88
IGL01629:Alpk2	APN	18	65300042	missense	probably damaging	1.00
IGL01872:Alpk2	APN	18	65304753	missense	probably benign	0.01
IGL01983:Alpk2	APN	18	65350682	missense	probably damaging	1.00
IGL02294:Alpk2	APN	18	65306075	missense	possibly damaging	0.45
IGL02333:Alpk2	APN	18	65349480	missense	probably damaging	0.99
IGL02493:Alpk2	APN	18	65350331	missense	probably benign	0.02
IGL02551:Alpk2	APN	18	65372751	missense	probably damaging	1.00
IGL02864:Alpk2	APN	18	65307599	missense	probably benign	0.12
IGL02901:Alpk2	APN	18	65306411	missense	probably benign
IGL02954:Alpk2	APN	18	65306136	missense	probably benign
IGL03257:Alpk2	APN	18	65349874	missense	probably damaging	0.99
IGL03389:Alpk2	APN	18	65304866	missense	possibly damaging	0.92
3-1:Alpk2	UTSW	18	65304888	missense	probably damaging	0.99
PIT4131001:Alpk2	UTSW	18	65306379	missense	possibly damaging	0.84
R0098:Alpk2	UTSW	18	65349911	missense	probably damaging	1.00
R0098:Alpk2	UTSW	18	65349911	missense	probably damaging	1.00
R0414:Alpk2	UTSW	18	65306159	missense	probably benign	0.04
R0546:Alpk2	UTSW	18	65306717	missense	probably benign	0.05
R0628:Alpk2	UTSW	18	65307296	missense	possibly damaging	0.94
R0658:Alpk2	UTSW	18	65349487	missense	probably damaging	1.00
R0731:Alpk2	UTSW	18	65305390	missense	probably damaging	0.98
R0919:Alpk2	UTSW	18	65307473	missense	probably benign
R1069:Alpk2	UTSW	18	65305014	missense	probably benign	0.25
R1186:Alpk2	UTSW	18	65294341	critical splice acceptor site	probably null
R1508:Alpk2	UTSW	18	65349305	missense	probably damaging	1.00
R1535:Alpk2	UTSW	18	65350204	missense	probably benign
R1558:Alpk2	UTSW	18	65350230	missense	probably benign
R1600:Alpk2	UTSW	18	65378037	missense	probably damaging	0.96
R1664:Alpk2	UTSW	18	65349873	missense	probably damaging	0.96
R1672:Alpk2	UTSW	18	65280959	missense	probably damaging	1.00
R1829:Alpk2	UTSW	18	65294094	missense	possibly damaging	0.75
R2110:Alpk2	UTSW	18	65307080	missense	possibly damaging	0.94
R2111:Alpk2	UTSW	18	65349774	missense	probably benign
R2113:Alpk2	UTSW	18	65305683	missense	probably benign	0.31
R2126:Alpk2	UTSW	18	65350368	nonsense	probably null
R2198:Alpk2	UTSW	18	65350184	missense	probably benign	0.42
R2227:Alpk2	UTSW	18	65378076	missense	probably damaging	1.00
R2245:Alpk2	UTSW	18	65305163	missense	probably benign	0.02
R2282:Alpk2	UTSW	18	65307626	missense	probably benign
R2421:Alpk2	UTSW	18	65306616	missense	probably benign	0.00
R2512:Alpk2	UTSW	18	65350520	missense	probably damaging	0.96
R3105:Alpk2	UTSW	18	65350210	missense	possibly damaging	0.57
R3700:Alpk2	UTSW	18	65305151	missense	probably damaging	0.99
R4205:Alpk2	UTSW	18	65305211	missense	possibly damaging	0.76
R4239:Alpk2	UTSW	18	65300141	missense	probably damaging	1.00
R4353:Alpk2	UTSW	18	65291452	missense	possibly damaging	0.73
R4572:Alpk2	UTSW	18	65281004	missense	probably damaging	1.00
R4584:Alpk2	UTSW	18	65306964	missense	probably damaging	0.99
R4591:Alpk2	UTSW	18	65305823	missense	probably benign	0.27
R4595:Alpk2	UTSW	18	65289748	missense	probably damaging	1.00
R4648:Alpk2	UTSW	18	65349882	missense	probably damaging	0.99
R4815:Alpk2	UTSW	18	65349955	missense	probably damaging	1.00
R4828:Alpk2	UTSW	18	65349113	missense	probably benign
R4910:Alpk2	UTSW	18	65266286	nonsense	probably null
R5042:Alpk2	UTSW	18	65350508	nonsense	probably null
R5295:Alpk2	UTSW	18	65305038	missense	probably damaging	0.98
R5375:Alpk2	UTSW	18	65372738	missense	probably damaging	1.00
R5475:Alpk2	UTSW	18	65307012	missense	probably benign	0.16
R5480:Alpk2	UTSW	18	65349908	missense	probably damaging	1.00
R5486:Alpk2	UTSW	18	65294354	splice site	probably null
R5503:Alpk2	UTSW	18	65306241	missense	probably benign	0.00
R5595:Alpk2	UTSW	18	65266248	missense	probably damaging	1.00
R5648:Alpk2	UTSW	18	65349917	missense	probably damaging	0.96
R5714:Alpk2	UTSW	18	65305461	missense	possibly damaging	0.55
R5862:Alpk2	UTSW	18	65307289	missense	probably damaging	1.00
R5894:Alpk2	UTSW	18	65281072	missense	probably damaging	0.99
R5898:Alpk2	UTSW	18	65307623	missense	probably damaging	0.99
R5936:Alpk2	UTSW	18	65350520	missense	probably damaging	0.96
R6142:Alpk2	UTSW	18	65305385	missense	possibly damaging	0.94
R6291:Alpk2	UTSW	18	65305901	missense	possibly damaging	0.93
R6339:Alpk2	UTSW	18	65349806	missense	probably benign	0.00
R6407:Alpk2	UTSW	18	65289738	missense	probably benign	0.22
R6487:Alpk2	UTSW	18	65266183	missense	possibly damaging	0.62
R6667:Alpk2	UTSW	18	65307740	missense	probably damaging	1.00
R6786:Alpk2	UTSW	18	65306634	missense	probably benign
R6833:Alpk2	UTSW	18	65306409	missense	probably benign	0.08
R6984:Alpk2	UTSW	18	65305678	missense	possibly damaging	0.95
R6999:Alpk2	UTSW	18	65304513	missense	probably damaging	0.99
R7157:Alpk2	UTSW	18	65266277	nonsense	probably null
R7167:Alpk2	UTSW	18	65306978	missense	probably benign	0.40
R7225:Alpk2	UTSW	18	65305199	missense	probably benign	0.00
R7409:Alpk2	UTSW	18	65306952	missense	probably benign	0.01
R7576:Alpk2	UTSW	18	65306816	missense	possibly damaging	0.89
R7589:Alpk2	UTSW	18	65300073	missense	probably damaging	1.00
R7598:Alpk2	UTSW	18	65304566	missense	probably damaging	1.00
R7664:Alpk2	UTSW	18	65307002	missense	probably benign	0.03
R7711:Alpk2	UTSW	18	65306484	missense	probably benign
R7722:Alpk2	UTSW	18	65350157	missense	probably damaging	1.00
R7783:Alpk2	UTSW	18	65306254	nonsense	probably null
R7806:Alpk2	UTSW	18	65349416	missense	probably benign
R7953:Alpk2	UTSW	18	65349830	missense	probably damaging	1.00
R8024:Alpk2	UTSW	18	65305035	missense	probably benign	0.01
R8043:Alpk2	UTSW	18	65349830	missense	probably damaging	1.00
R8063:Alpk2	UTSW	18	65350346	missense	probably benign	0.15
R8171:Alpk2	UTSW	18	65305983	missense	probably benign	0.00
R8280:Alpk2	UTSW	18	65307203	missense	probably benign
R8383:Alpk2	UTSW	18	65305398	missense	probably benign	0.03
R8414:Alpk2	UTSW	18	65307471	missense	possibly damaging	0.89
R8791:Alpk2	UTSW	18	65305526	missense	probably benign	0.00
R8872:Alpk2	UTSW	18	65280906	missense	probably damaging	1.00
R9352:Alpk2	UTSW	18	65306712	missense	probably benign	0.01
R9449:Alpk2	UTSW	18	65291393	missense	probably damaging	1.00
X0023:Alpk2	UTSW	18	65291400	missense	probably damaging	1.00
X0027:Alpk2	UTSW	18	65307471	missense	possibly damaging	0.89
X0063:Alpk2	UTSW	18	65307363	missense	probably benign
X0064:Alpk2	UTSW	18	65349684	missense	probably benign	0.09
Z1176:Alpk2	UTSW	18	65305611	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGCCCTTCAATGCTGCTAAAC -3'
(R):5'- CCAAAAGCTTGTTACGTAGGGAC -3'

Sequencing Primer
(F):5'- GCTAAACACAGCAGTCTCACCTTTC -3'
(R):5'- AAGCTTGTTACGTAGGGACCCATG -3'

Posted On

2019-10-17