Mutagenetix > Incidental Mutation

Incidental Mutation 'R4572:Alpk2'

342230

Institutional Source

Beutler Lab

Gene Symbol

Alpk2

Ensembl Gene

ENSMUSG00000032845

Gene Name

alpha-kinase 2

Synonyms

Hak

MMRRC Submission

041796-MU

Accession Numbers

Genbank: NM_001037294

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4572 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65265529-65393888 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 65281004 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 2014 (S2014T)

Ref Sequence

ENSEMBL: ENSMUSP00000048752 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035548] [ENSMUST00000141250]

AlphaFold

Q91ZB0

Predicted Effect

probably damaging
Transcript: ENSMUST00000035548
AA Change: S2014T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000048752
Gene: ENSMUSG00000032845
AA Change: S2014T

Domain	Start	End	E-Value	Type
IGc2	24	94	9.34e-4	SMART
low complexity region	196	209	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	1025	1037	N/A	INTRINSIC
low complexity region	1337	1353	N/A	INTRINSIC
IG	1766	1849	2.27e-2	SMART
Alpha_kinase	1879	2098	3.72e-79	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000141250
AA Change: S1547T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000114658
Gene: ENSMUSG00000032845
AA Change: S1547T

Domain	Start	End	E-Value	Type
low complexity region	255	267	N/A	INTRINSIC
low complexity region	558	570	N/A	INTRINSIC
low complexity region	870	886	N/A	INTRINSIC
IG	1299	1382	2.27e-2	SMART
Alpha_kinase	1412	1603	2.45e-56	SMART

Meta Mutation Damage Score

0.5235

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (71/71)

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	T	11: 110,216,548	I747N	probably benign	Het
Adamtsl2	A	G	2: 27,083,256	Y97C	probably damaging	Het
Alox12e	A	G	11: 70,321,181		probably benign	Het
Ankrd36	A	T	11: 5,689,340		probably null	Het
Apobec1	T	C	6: 122,581,397	D133G	probably damaging	Het
Arfgef1	A	T	1: 10,213,141	I181N	probably damaging	Het
C130060K24Rik	A	T	6: 65,454,991	M293L	probably benign	Het
Cilp2	A	G	8: 69,882,410	V646A	probably damaging	Het
Clasrp	A	G	7: 19,584,464		probably null	Het
Cnot2	T	C	10: 116,494,846	T423A	probably benign	Het
Crtap	T	C	9: 114,384,806	D227G	probably benign	Het
Cyp17a1	A	G	19: 46,670,551	F217S	probably damaging	Het
Ddx60	A	G	8: 61,987,421	M1036V	probably damaging	Het
Dnah11	A	T	12: 118,010,125	I2818N	probably benign	Het
Dok6	T	A	18: 89,473,947	I169F	possibly damaging	Het
Duox2	T	A	2: 122,281,726	R1326S	probably benign	Het
Epha10	A	G	4: 124,902,568	T357A	unknown	Het
Ephb2	A	C	4: 136,655,940	F942C	probably damaging	Het
Fscn3	T	A	6: 28,430,635		probably null	Het
Gabrb2	A	G	11: 42,593,917	N267S	possibly damaging	Het
Gabrr3	A	T	16: 59,461,638	Y452F	probably benign	Het
Gen1	A	G	12: 11,242,418	S457P	probably damaging	Het
Gm1993	C	T	X: 25,560,356	R77H	probably damaging	Het
Gm5592	G	A	7: 41,216,159		probably benign	Het
Hmbox1	A	G	14: 64,903,233		probably null	Het
Hus1	A	T	11: 9,007,617		probably null	Het
Ino80	G	A	2: 119,402,358	R1160W	probably damaging	Het
Kalrn	A	T	16: 34,392,042	F27L	probably damaging	Het
Kri1	A	T	9: 21,280,384	F187L	probably damaging	Het
Lekr1	A	T	3: 65,783,915		noncoding transcript	Het
Mapk15	T	C	15: 75,998,750		probably benign	Het
Mrgpre	G	A	7: 143,781,104	L221F	probably damaging	Het
Mrpl50	A	T	4: 49,514,399	S91T	possibly damaging	Het
Muc4	T	C	16: 32,753,802	I1226T	probably benign	Het
Mup15	A	G	4: 61,438,217		probably null	Het
Ncapd3	A	G	9: 27,094,615	D1469G	probably damaging	Het
Nlrp9b	G	A	7: 20,026,681		probably null	Het
Npy6r	A	T	18: 44,275,917	Y135F	probably benign	Het
Olfr862	A	C	9: 19,883,979	C109G	probably benign	Het
Phf14	G	A	6: 12,006,824	R825Q	probably damaging	Het
Pigg	A	G	5: 108,332,885	M379V	probably benign	Het
Plppr3	T	A	10: 79,866,063	Q315L	probably benign	Het
Plxnd1	C	A	6: 115,955,756	C1921F	probably damaging	Het
Ptger4	A	C	15: 5,243,133	S2A	probably benign	Het
Rab4a	A	T	8: 123,834,060	D196V	probably benign	Het
Rbck1	G	A	2: 152,318,733	Q428*	probably null	Het
Rgs14	A	T	13: 55,380,062	N266I	probably damaging	Het
Serpina1c	A	T	12: 103,898,708		probably benign	Het
Sesn3	G	A	9: 14,321,220	R263H	probably benign	Het
Slfn1	A	T	11: 83,121,463	D135V	probably benign	Het
Spata17	T	C	1: 187,193,996	K46E	possibly damaging	Het
Srcin1	A	C	11: 97,534,934	D432E	probably damaging	Het
Stxbp5	T	C	10: 9,838,144	E217G	probably damaging	Het
Terf2ip	A	G	8: 112,012,017	D179G	probably damaging	Het
Tll1	A	G	8: 64,056,309	F556L	possibly damaging	Het
Tmed4	CTCTTTCT	CTCT	11: 6,274,461		probably null	Het
Trappc9	G	T	15: 72,937,067	Q537K	possibly damaging	Het
Trim30a	G	T	7: 104,411,188	C460*	probably null	Het
Trim35	T	C	14: 66,307,873	Y298H	probably damaging	Het
Ugt3a1	T	A	15: 9,306,393	H209Q	probably benign	Het
Ulk4	T	C	9: 121,192,764	K627R	probably damaging	Het
Wnk1	T	C	6: 119,951,911	T1319A	possibly damaging	Het
Wnt9b	G	A	11: 103,732,155	R141C	probably damaging	Het
Zfp735	A	G	11: 73,689,785	M37V	probably benign	Het
Zmym1	A	T	4: 127,050,835	N186K	probably benign	Het

Other mutations in Alpk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Alpk2	APN	18	65305823	missense	probably benign	0.27
IGL00478:Alpk2	APN	18	65307226	nonsense	probably null
IGL00898:Alpk2	APN	18	65350573	missense	probably benign	0.29
IGL00978:Alpk2	APN	18	65291534	splice site	probably benign
IGL01093:Alpk2	APN	18	65349329	missense	probably damaging	0.98
IGL01094:Alpk2	APN	18	65306602	missense	probably damaging	0.96
IGL01109:Alpk2	APN	18	65307140	missense	probably benign	0.09
IGL01370:Alpk2	APN	18	65350591	missense	possibly damaging	0.56
IGL01393:Alpk2	APN	18	65307708	missense	possibly damaging	0.88
IGL01629:Alpk2	APN	18	65300042	missense	probably damaging	1.00
IGL01872:Alpk2	APN	18	65304753	missense	probably benign	0.01
IGL01983:Alpk2	APN	18	65350682	missense	probably damaging	1.00
IGL02294:Alpk2	APN	18	65306075	missense	possibly damaging	0.45
IGL02333:Alpk2	APN	18	65349480	missense	probably damaging	0.99
IGL02493:Alpk2	APN	18	65350331	missense	probably benign	0.02
IGL02551:Alpk2	APN	18	65372751	missense	probably damaging	1.00
IGL02864:Alpk2	APN	18	65307599	missense	probably benign	0.12
IGL02901:Alpk2	APN	18	65306411	missense	probably benign
IGL02954:Alpk2	APN	18	65306136	missense	probably benign
IGL03257:Alpk2	APN	18	65349874	missense	probably damaging	0.99
IGL03389:Alpk2	APN	18	65304866	missense	possibly damaging	0.92
3-1:Alpk2	UTSW	18	65304888	missense	probably damaging	0.99
PIT4131001:Alpk2	UTSW	18	65306379	missense	possibly damaging	0.84
R0098:Alpk2	UTSW	18	65349911	missense	probably damaging	1.00
R0098:Alpk2	UTSW	18	65349911	missense	probably damaging	1.00
R0414:Alpk2	UTSW	18	65306159	missense	probably benign	0.04
R0546:Alpk2	UTSW	18	65306717	missense	probably benign	0.05
R0628:Alpk2	UTSW	18	65307296	missense	possibly damaging	0.94
R0658:Alpk2	UTSW	18	65349487	missense	probably damaging	1.00
R0731:Alpk2	UTSW	18	65305390	missense	probably damaging	0.98
R0919:Alpk2	UTSW	18	65307473	missense	probably benign
R1069:Alpk2	UTSW	18	65305014	missense	probably benign	0.25
R1186:Alpk2	UTSW	18	65294341	critical splice acceptor site	probably null
R1508:Alpk2	UTSW	18	65349305	missense	probably damaging	1.00
R1535:Alpk2	UTSW	18	65350204	missense	probably benign
R1558:Alpk2	UTSW	18	65350230	missense	probably benign
R1600:Alpk2	UTSW	18	65378037	missense	probably damaging	0.96
R1664:Alpk2	UTSW	18	65349873	missense	probably damaging	0.96
R1672:Alpk2	UTSW	18	65280959	missense	probably damaging	1.00
R1829:Alpk2	UTSW	18	65294094	missense	possibly damaging	0.75
R2110:Alpk2	UTSW	18	65307080	missense	possibly damaging	0.94
R2111:Alpk2	UTSW	18	65349774	missense	probably benign
R2113:Alpk2	UTSW	18	65305683	missense	probably benign	0.31
R2126:Alpk2	UTSW	18	65350368	nonsense	probably null
R2198:Alpk2	UTSW	18	65350184	missense	probably benign	0.42
R2227:Alpk2	UTSW	18	65378076	missense	probably damaging	1.00
R2245:Alpk2	UTSW	18	65305163	missense	probably benign	0.02
R2282:Alpk2	UTSW	18	65307626	missense	probably benign
R2421:Alpk2	UTSW	18	65306616	missense	probably benign	0.00
R2512:Alpk2	UTSW	18	65350520	missense	probably damaging	0.96
R3105:Alpk2	UTSW	18	65350210	missense	possibly damaging	0.57
R3700:Alpk2	UTSW	18	65305151	missense	probably damaging	0.99
R4205:Alpk2	UTSW	18	65305211	missense	possibly damaging	0.76
R4239:Alpk2	UTSW	18	65300141	missense	probably damaging	1.00
R4353:Alpk2	UTSW	18	65291452	missense	possibly damaging	0.73
R4584:Alpk2	UTSW	18	65306964	missense	probably damaging	0.99
R4591:Alpk2	UTSW	18	65305823	missense	probably benign	0.27
R4595:Alpk2	UTSW	18	65289748	missense	probably damaging	1.00
R4648:Alpk2	UTSW	18	65349882	missense	probably damaging	0.99
R4815:Alpk2	UTSW	18	65349955	missense	probably damaging	1.00
R4828:Alpk2	UTSW	18	65349113	missense	probably benign
R4910:Alpk2	UTSW	18	65266286	nonsense	probably null
R5042:Alpk2	UTSW	18	65350508	nonsense	probably null
R5295:Alpk2	UTSW	18	65305038	missense	probably damaging	0.98
R5375:Alpk2	UTSW	18	65372738	missense	probably damaging	1.00
R5475:Alpk2	UTSW	18	65307012	missense	probably benign	0.16
R5480:Alpk2	UTSW	18	65349908	missense	probably damaging	1.00
R5486:Alpk2	UTSW	18	65294354	splice site	probably null
R5503:Alpk2	UTSW	18	65306241	missense	probably benign	0.00
R5595:Alpk2	UTSW	18	65266248	missense	probably damaging	1.00
R5648:Alpk2	UTSW	18	65349917	missense	probably damaging	0.96
R5714:Alpk2	UTSW	18	65305461	missense	possibly damaging	0.55
R5862:Alpk2	UTSW	18	65307289	missense	probably damaging	1.00
R5894:Alpk2	UTSW	18	65281072	missense	probably damaging	0.99
R5898:Alpk2	UTSW	18	65307623	missense	probably damaging	0.99
R5936:Alpk2	UTSW	18	65350520	missense	probably damaging	0.96
R6142:Alpk2	UTSW	18	65305385	missense	possibly damaging	0.94
R6291:Alpk2	UTSW	18	65305901	missense	possibly damaging	0.93
R6339:Alpk2	UTSW	18	65349806	missense	probably benign	0.00
R6407:Alpk2	UTSW	18	65289738	missense	probably benign	0.22
R6487:Alpk2	UTSW	18	65266183	missense	possibly damaging	0.62
R6667:Alpk2	UTSW	18	65307740	missense	probably damaging	1.00
R6786:Alpk2	UTSW	18	65306634	missense	probably benign
R6833:Alpk2	UTSW	18	65306409	missense	probably benign	0.08
R6984:Alpk2	UTSW	18	65305678	missense	possibly damaging	0.95
R6999:Alpk2	UTSW	18	65304513	missense	probably damaging	0.99
R7157:Alpk2	UTSW	18	65266277	nonsense	probably null
R7167:Alpk2	UTSW	18	65306978	missense	probably benign	0.40
R7225:Alpk2	UTSW	18	65305199	missense	probably benign	0.00
R7409:Alpk2	UTSW	18	65306952	missense	probably benign	0.01
R7533:Alpk2	UTSW	18	65304603	missense	probably damaging	1.00
R7576:Alpk2	UTSW	18	65306816	missense	possibly damaging	0.89
R7589:Alpk2	UTSW	18	65300073	missense	probably damaging	1.00
R7598:Alpk2	UTSW	18	65304566	missense	probably damaging	1.00
R7664:Alpk2	UTSW	18	65307002	missense	probably benign	0.03
R7711:Alpk2	UTSW	18	65306484	missense	probably benign
R7722:Alpk2	UTSW	18	65350157	missense	probably damaging	1.00
R7783:Alpk2	UTSW	18	65306254	nonsense	probably null
R7806:Alpk2	UTSW	18	65349416	missense	probably benign
R7953:Alpk2	UTSW	18	65349830	missense	probably damaging	1.00
R8024:Alpk2	UTSW	18	65305035	missense	probably benign	0.01
R8043:Alpk2	UTSW	18	65349830	missense	probably damaging	1.00
R8063:Alpk2	UTSW	18	65350346	missense	probably benign	0.15
R8171:Alpk2	UTSW	18	65305983	missense	probably benign	0.00
R8280:Alpk2	UTSW	18	65307203	missense	probably benign
R8383:Alpk2	UTSW	18	65305398	missense	probably benign	0.03
R8414:Alpk2	UTSW	18	65307471	missense	possibly damaging	0.89
R8791:Alpk2	UTSW	18	65305526	missense	probably benign	0.00
R8872:Alpk2	UTSW	18	65280906	missense	probably damaging	1.00
R9352:Alpk2	UTSW	18	65306712	missense	probably benign	0.01
R9449:Alpk2	UTSW	18	65291393	missense	probably damaging	1.00
R9525:Alpk2	UTSW	18	65266217	missense	probably damaging	1.00
R9564:Alpk2	UTSW	18	65305943	missense	not run
X0023:Alpk2	UTSW	18	65291400	missense	probably damaging	1.00
X0027:Alpk2	UTSW	18	65307471	missense	possibly damaging	0.89
X0063:Alpk2	UTSW	18	65307363	missense	probably benign
X0064:Alpk2	UTSW	18	65349684	missense	probably benign	0.09
Z1176:Alpk2	UTSW	18	65305611	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GAGAAGATGCTTGTTGGTACCC -3'
(R):5'- TTGACCATGTGTCCTGCTGC -3'

Sequencing Primer
(F):5'- TGGTACCCAACAGACCTTTC -3'
(R):5'- ATGTGTCCTGCTGCTCCAG -3'

Posted On

2015-09-24