Incidental Mutation 'R7555:Dcbld2'
ID585998
Institutional Source Beutler Lab
Gene Symbol Dcbld2
Ensembl Gene ENSMUSG00000035107
Gene Namediscoidin, CUB and LCCL domain containing 2
SynonymsEsdn, 1700055P21Rik, CLCP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7555 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location58408443-58469727 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 58448718 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046663]
Predicted Effect probably null
Transcript: ENSMUST00000046663
SMART Domains Protein: ENSMUSP00000039915
Gene: ENSMUSG00000035107

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
CUB 69 184 4.26e-37 SMART
LCCL 188 273 4.74e-37 SMART
FA58C 288 446 4.08e-28 SMART
transmembrane domain 522 544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (83/83)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced postnatal angiogenesis and impaired recovery from femoral artery ligation with impaired blood flow and decreased capillary density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T A 4: 144,522,354 I97N probably damaging Het
Acvrl1 A G 15: 101,143,473 H502R probably benign Het
Adgrf4 T C 17: 42,672,603 S63G probably benign Het
Agbl2 C A 2: 90,791,555 L129I probably damaging Het
Ankrd11 C A 8: 122,887,406 A2542S probably damaging Het
Armc9 A G 1: 86,275,678 K818R probably damaging Het
Arsj T A 3: 126,438,236 C210* probably null Het
Aspscr1 C T 11: 120,673,100 A11V unknown Het
Bicc1 G T 10: 70,956,291 Q296K possibly damaging Het
Borcs5 A C 6: 134,685,979 Q73P probably benign Het
Capn15 G T 17: 25,963,432 D567E probably damaging Het
Catsperg1 A C 7: 29,189,814 I866S probably damaging Het
Ccdc27 G T 4: 154,041,817 H72N unknown Het
Ccser2 A T 14: 36,879,500 M309K possibly damaging Het
Cd1d2 A G 3: 86,987,101 S59G probably benign Het
Chml G A 1: 175,687,890 P155L probably benign Het
Csmd2 C T 4: 128,452,458 P1504S Het
Ddx21 C T 10: 62,598,243 E246K probably benign Het
Dhx29 C T 13: 112,927,642 probably benign Het
Dis3l A C 9: 64,311,937 Y570* probably null Het
Dnah14 T A 1: 181,770,054 Y3623N probably benign Het
Dock8 A G 19: 25,175,400 D1610G probably damaging Het
Dync1h1 T C 12: 110,630,625 S1669P probably benign Het
Eif2ak4 T A 2: 118,417,283 I267N possibly damaging Het
Ern2 A T 7: 122,170,241 V854E probably damaging Het
Fuca2 G A 10: 13,507,430 probably null Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gm1110 T A 9: 26,893,628 T380S probably benign Het
Gm13128 T C 4: 144,332,741 F341L probably benign Het
Gm5788 A C 12: 87,494,735 K5N unknown Het
Gm6460 A T 5: 11,597,612 N106Y probably damaging Het
Golga2 G A 2: 32,288,166 R29H probably benign Het
Grik5 T C 7: 25,060,597 E259G probably benign Het
Grm3 T C 5: 9,570,000 T415A probably benign Het
Gtf3c1 A G 7: 125,645,670 Y1731H probably damaging Het
Hectd2 T C 19: 36,612,403 C643R probably damaging Het
Hgfac T C 5: 35,042,628 S118P probably damaging Het
Hmcn1 A G 1: 150,604,874 V4517A probably benign Het
Hnrnpc A T 14: 52,075,153 L290* probably null Het
Homer3 A G 8: 70,289,413 E108G probably damaging Het
Hsd17b3 G T 13: 64,072,002 S141R probably benign Het
Hspa12b C T 2: 131,138,476 T105I probably damaging Het
Ifi202b T C 1: 173,972,221 I231M probably damaging Het
Inhba T A 13: 16,017,637 N114K probably benign Het
Kmt2b C A 7: 30,569,410 M2631I possibly damaging Het
Loxhd1 C T 18: 77,395,365 T1214I probably damaging Het
Lrp1 G T 10: 127,546,862 N3683K probably damaging Het
Lrrc8e A G 8: 4,234,363 K196R probably benign Het
Lrrn3 A T 12: 41,452,911 M469K probably benign Het
Mafb T C 2: 160,365,829 E283G probably damaging Het
Mapt C A 11: 104,298,702 P182Q probably benign Het
Mmp14 G T 14: 54,437,742 R277L possibly damaging Het
Mucl2 T A 15: 103,897,445 N82I probably benign Het
Nsun6 T A 2: 14,996,339 T469S possibly damaging Het
Olfr1076 A C 2: 86,509,347 D296A probably damaging Het
Olfr1342 T C 4: 118,689,642 D270G possibly damaging Het
Olfr507 G C 7: 108,622,726 A305P probably damaging Het
Osbpl5 A T 7: 143,694,933 F631I possibly damaging Het
Otud3 G T 4: 138,901,885 D190E possibly damaging Het
Pcdhb6 A T 18: 37,335,279 I418F possibly damaging Het
Per1 G A 11: 69,106,513 R838H probably damaging Het
Per2 G A 1: 91,435,135 P395S probably damaging Het
Per3 G A 4: 151,018,058 Q583* probably null Het
Pkhd1l1 A T 15: 44,550,761 H2808L possibly damaging Het
Ppfia2 A G 10: 106,927,826 T1227A probably benign Het
Psg17 C T 7: 18,817,094 D279N probably benign Het
Rnf167 A G 11: 70,650,797 D235G probably benign Het
Rxfp3 A G 15: 11,036,276 S337P probably damaging Het
Sall1 T C 8: 89,033,158 D106G possibly damaging Het
Sema4f A G 6: 82,914,056 V590A probably benign Het
Setd1b A G 5: 123,157,757 D1102G unknown Het
Six2 C A 17: 85,687,707 K82N probably damaging Het
Snx29 T C 16: 11,400,942 M214T probably benign Het
Son T C 16: 91,658,922 L1519P probably damaging Het
Spin1 C T 13: 51,149,049 S226L probably benign Het
Stxbp5l T C 16: 37,323,603 D131G probably damaging Het
Svep1 T C 4: 58,069,422 Y2788C probably damaging Het
Tbl3 C A 17: 24,701,976 probably null Het
Themis A T 10: 28,781,702 I242L possibly damaging Het
Tmem203 G A 2: 25,255,730 V21M probably benign Het
Trp53inp1 T C 4: 11,169,750 C171R probably benign Het
Tsg101 A G 7: 46,913,411 Y32H probably damaging Het
Tyw1 A G 5: 130,274,706 D305G probably damaging Het
Vmn1r40 A T 6: 89,715,044 Y281F probably damaging Het
Vmn2r105 T A 17: 20,227,675 T296S probably damaging Het
Vmn2r13 T C 5: 109,171,691 probably null Het
Zfp933 A G 4: 147,826,132 F336L probably damaging Het
Other mutations in Dcbld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Dcbld2 APN 16 58408873 missense possibly damaging 0.75
IGL01978:Dcbld2 APN 16 58464319 missense probably benign 0.00
IGL02143:Dcbld2 APN 16 58448526 critical splice donor site probably null
IGL02953:Dcbld2 APN 16 58451737 missense probably benign 0.29
IGL03109:Dcbld2 APN 16 58456402 missense probably benign 0.06
IGL03131:Dcbld2 APN 16 58451688 missense probably benign 0.00
R0183:Dcbld2 UTSW 16 58445359 missense possibly damaging 0.70
R0305:Dcbld2 UTSW 16 58448939 missense probably damaging 1.00
R0316:Dcbld2 UTSW 16 58433445 missense probably damaging 1.00
R0371:Dcbld2 UTSW 16 58450823 missense probably benign 0.09
R0548:Dcbld2 UTSW 16 58455145 missense probably damaging 0.98
R0751:Dcbld2 UTSW 16 58449841 critical splice donor site probably null
R0906:Dcbld2 UTSW 16 58455247 missense probably damaging 1.00
R1184:Dcbld2 UTSW 16 58449841 critical splice donor site probably null
R1557:Dcbld2 UTSW 16 58465350 missense possibly damaging 0.49
R1995:Dcbld2 UTSW 16 58456332 missense probably benign
R3930:Dcbld2 UTSW 16 58465338 missense probably damaging 1.00
R3931:Dcbld2 UTSW 16 58465338 missense probably damaging 1.00
R4080:Dcbld2 UTSW 16 58465373 missense probably damaging 1.00
R4385:Dcbld2 UTSW 16 58463066 missense probably damaging 0.96
R4615:Dcbld2 UTSW 16 58456094 missense probably benign 0.03
R4739:Dcbld2 UTSW 16 58460976 missense probably damaging 1.00
R4963:Dcbld2 UTSW 16 58465782 missense probably benign
R4968:Dcbld2 UTSW 16 58424711 missense probably damaging 1.00
R5419:Dcbld2 UTSW 16 58455258 missense probably damaging 0.99
R5684:Dcbld2 UTSW 16 58449809 missense possibly damaging 0.90
R5737:Dcbld2 UTSW 16 58460985 missense probably damaging 1.00
R6277:Dcbld2 UTSW 16 58451756 missense probably damaging 0.97
R6277:Dcbld2 UTSW 16 58465503 missense probably damaging 1.00
R6468:Dcbld2 UTSW 16 58433373 nonsense probably null
R6753:Dcbld2 UTSW 16 58456130 missense possibly damaging 0.94
R7213:Dcbld2 UTSW 16 58450763 missense probably benign 0.02
R7360:Dcbld2 UTSW 16 58465320 splice site probably null
R7570:Dcbld2 UTSW 16 58424569 missense possibly damaging 0.86
R7593:Dcbld2 UTSW 16 58424578 missense possibly damaging 0.82
R8072:Dcbld2 UTSW 16 58463097 nonsense probably null
R8175:Dcbld2 UTSW 16 58433347 missense possibly damaging 0.63
R8193:Dcbld2 UTSW 16 58464010 splice site probably null
R8323:Dcbld2 UTSW 16 58463110 critical splice donor site probably null
R8804:Dcbld2 UTSW 16 58461049 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- CTTCGCTGCTGTGGATACTG -3'
(R):5'- CCGTGGAAGTGACATTGTTG -3'

Sequencing Primer
(F):5'- CTGCTGTGGATACTGTTATTTTAAAC -3'
(R):5'- AGAGCTTTCATAATATGGGGTCCC -3'
Posted On2019-10-18