Incidental Mutation 'R7555:Hgfac'
ID 584685
Institutional Source Beutler Lab
Gene Symbol Hgfac
Ensembl Gene ENSMUSG00000029102
Gene Name hepatocyte growth factor activator
Synonyms HGFA
MMRRC Submission 045623-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R7555 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 35198853-35205805 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35199972 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 118 (S118P)
Ref Sequence ENSEMBL: ENSMUSP00000030985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030985] [ENSMUST00000087684] [ENSMUST00000114283] [ENSMUST00000114285] [ENSMUST00000202573]
AlphaFold Q9R098
Predicted Effect probably damaging
Transcript: ENSMUST00000030985
AA Change: S118P

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030985
Gene: ENSMUSG00000029102
AA Change: S118P

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
FN2 98 145 7.31e-27 SMART
EGF 160 195 2.11e-4 SMART
Pfam:fn1 199 234 7.7e-11 PFAM
EGF 241 276 1.69e-3 SMART
KR 281 366 5.2e-36 SMART
Tryp_SPc 405 639 2.07e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087684
SMART Domains Protein: ENSMUSP00000084970
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
PDZ 29 98 5.25e-18 SMART
PTB 224 373 5.05e-28 SMART
low complexity region 443 456 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
RGS 715 832 2.84e-41 SMART
Pfam:RGS12_us1 836 953 4.3e-61 PFAM
RBD 962 1032 3.12e-28 SMART
RBD 1034 1104 2.44e-21 SMART
Pfam:RGS12_us2 1106 1180 2.4e-37 PFAM
GoLoco 1187 1209 9.74e-9 SMART
Pfam:RGS12_usC 1238 1379 9.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114283
SMART Domains Protein: ENSMUSP00000109922
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
RGS 57 174 2.84e-41 SMART
low complexity region 191 207 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
low complexity region 253 270 N/A INTRINSIC
RBD 304 374 3.12e-28 SMART
RBD 376 446 2.44e-21 SMART
GoLoco 529 551 9.74e-9 SMART
low complexity region 601 622 N/A INTRINSIC
low complexity region 634 650 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114285
SMART Domains Protein: ENSMUSP00000109924
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
low complexity region 37 49 N/A INTRINSIC
RGS 67 184 2.84e-41 SMART
low complexity region 201 217 N/A INTRINSIC
low complexity region 220 232 N/A INTRINSIC
low complexity region 263 280 N/A INTRINSIC
RBD 314 384 3.12e-28 SMART
RBD 386 456 2.44e-21 SMART
GoLoco 539 561 9.74e-9 SMART
low complexity region 611 632 N/A INTRINSIC
low complexity region 644 660 N/A INTRINSIC
low complexity region 707 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150139
SMART Domains Protein: ENSMUSP00000117158
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
Blast:RBD 2 33 5e-13 BLAST
Pfam:RGS12_us2 35 80 5.8e-13 PFAM
Predicted Effect silent
Transcript: ENSMUST00000202573
SMART Domains Protein: ENSMUSP00000144344
Gene: ENSMUSG00000029102

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202921
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: This gene encodes a serine protease enzyme that proteolytically activates hepatocyte growth factor (HGF) and plays a vital role in the regulation of HGF activity in the regeneration and repair of various tissues. The encoded protein is an inactive zymogen that is proteolytically activated to generate a heterodimeric enzyme consisting of a short chain and a long chain linked by a disulfide bridge. Mice lacking the encoded protein display an impairment in mucosal regeneration after injury. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous null mice display impaired intestinal regeneration and increased mortality after intestinal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm1 T A 4: 144,248,924 (GRCm39) I97N probably damaging Het
Acvrl1 A G 15: 101,041,354 (GRCm39) H502R probably benign Het
Adgrf4 T C 17: 42,983,494 (GRCm39) S63G probably benign Het
Agbl2 C A 2: 90,621,899 (GRCm39) L129I probably damaging Het
Ankrd11 C A 8: 123,614,145 (GRCm39) A2542S probably damaging Het
Armc9 A G 1: 86,203,400 (GRCm39) K818R probably damaging Het
Arsj T A 3: 126,231,885 (GRCm39) C210* probably null Het
Aspscr1 C T 11: 120,563,926 (GRCm39) A11V unknown Het
Bicc1 G T 10: 70,792,121 (GRCm39) Q296K possibly damaging Het
Borcs5 A C 6: 134,662,942 (GRCm39) Q73P probably benign Het
Capn15 G T 17: 26,182,406 (GRCm39) D567E probably damaging Het
Catsperg1 A C 7: 28,889,239 (GRCm39) I866S probably damaging Het
Ccdc27 G T 4: 154,126,274 (GRCm39) H72N unknown Het
Ccser2 A T 14: 36,601,457 (GRCm39) M309K possibly damaging Het
Cd1d2 A G 3: 86,894,408 (GRCm39) S59G probably benign Het
Chml G A 1: 175,515,456 (GRCm39) P155L probably benign Het
Csmd2 C T 4: 128,346,251 (GRCm39) P1504S Het
Dcbld2 A G 16: 58,269,081 (GRCm39) probably null Het
Ddx21 C T 10: 62,434,022 (GRCm39) E246K probably benign Het
Dhx29 C T 13: 113,064,176 (GRCm39) probably benign Het
Dis3l A C 9: 64,219,219 (GRCm39) Y570* probably null Het
Dnah14 T A 1: 181,597,619 (GRCm39) Y3623N probably benign Het
Dock8 A G 19: 25,152,764 (GRCm39) D1610G probably damaging Het
Dync1h1 T C 12: 110,597,059 (GRCm39) S1669P probably benign Het
Eif1ad12 A C 12: 87,541,505 (GRCm39) K5N unknown Het
Eif2ak4 T A 2: 118,247,764 (GRCm39) I267N possibly damaging Het
Ern2 A T 7: 121,769,464 (GRCm39) V854E probably damaging Het
Fuca2 G A 10: 13,383,174 (GRCm39) probably null Het
Gbp10 G A 5: 105,384,015 (GRCm39) probably benign Het
Gm1110 T A 9: 26,804,924 (GRCm39) T380S probably benign Het
Golga2 G A 2: 32,178,178 (GRCm39) R29H probably benign Het
Grik5 T C 7: 24,760,022 (GRCm39) E259G probably benign Het
Grm3 T C 5: 9,620,000 (GRCm39) T415A probably benign Het
Gtf3c1 A G 7: 125,244,842 (GRCm39) Y1731H probably damaging Het
Hectd2 T C 19: 36,589,803 (GRCm39) C643R probably damaging Het
Hmcn1 A G 1: 150,480,625 (GRCm39) V4517A probably benign Het
Hnrnpc A T 14: 52,312,610 (GRCm39) L290* probably null Het
Homer3 A G 8: 70,742,063 (GRCm39) E108G probably damaging Het
Hsd17b3 G T 13: 64,219,816 (GRCm39) S141R probably benign Het
Hspa12b C T 2: 130,980,396 (GRCm39) T105I probably damaging Het
Ifi202b T C 1: 173,799,787 (GRCm39) I231M probably damaging Het
Inhba T A 13: 16,192,222 (GRCm39) N114K probably benign Het
Kmt2b C A 7: 30,268,835 (GRCm39) M2631I possibly damaging Het
Loxhd1 C T 18: 77,483,061 (GRCm39) T1214I probably damaging Het
Lrp1 G T 10: 127,382,731 (GRCm39) N3683K probably damaging Het
Lrrc8e A G 8: 4,284,363 (GRCm39) K196R probably benign Het
Lrrn3 A T 12: 41,502,910 (GRCm39) M469K probably benign Het
Mafb T C 2: 160,207,749 (GRCm39) E283G probably damaging Het
Mapt C A 11: 104,189,528 (GRCm39) P182Q probably benign Het
Mmp14 G T 14: 54,675,199 (GRCm39) R277L possibly damaging Het
Mucl2 T A 15: 103,927,711 (GRCm39) N82I probably benign Het
Nsun6 T A 2: 15,001,150 (GRCm39) T469S possibly damaging Het
Or13p4 T C 4: 118,546,839 (GRCm39) D270G possibly damaging Het
Or5p79 G C 7: 108,221,933 (GRCm39) A305P probably damaging Het
Or8k30 A C 2: 86,339,691 (GRCm39) D296A probably damaging Het
Osbpl5 A T 7: 143,248,670 (GRCm39) F631I possibly damaging Het
Otud3 G T 4: 138,629,196 (GRCm39) D190E possibly damaging Het
Pcdhb6 A T 18: 37,468,332 (GRCm39) I418F possibly damaging Het
Per1 G A 11: 68,997,339 (GRCm39) R838H probably damaging Het
Per2 G A 1: 91,362,857 (GRCm39) P395S probably damaging Het
Per3 G A 4: 151,102,515 (GRCm39) Q583* probably null Het
Pkhd1l1 A T 15: 44,414,157 (GRCm39) H2808L possibly damaging Het
Ppfia2 A G 10: 106,763,687 (GRCm39) T1227A probably benign Het
Pramel30 T C 4: 144,059,311 (GRCm39) F341L probably benign Het
Psg17 C T 7: 18,551,019 (GRCm39) D279N probably benign Het
Rnf167 A G 11: 70,541,623 (GRCm39) D235G probably benign Het
Rxfp3 A G 15: 11,036,362 (GRCm39) S337P probably damaging Het
Sall1 T C 8: 89,759,786 (GRCm39) D106G possibly damaging Het
Sema4f A G 6: 82,891,037 (GRCm39) V590A probably benign Het
Setd1b A G 5: 123,295,820 (GRCm39) D1102G unknown Het
Six2 C A 17: 85,995,135 (GRCm39) K82N probably damaging Het
Snx29 T C 16: 11,218,806 (GRCm39) M214T probably benign Het
Son T C 16: 91,455,810 (GRCm39) L1519P probably damaging Het
Speer1h A T 5: 11,647,579 (GRCm39) N106Y probably damaging Het
Spin1 C T 13: 51,303,085 (GRCm39) S226L probably benign Het
Stxbp5l T C 16: 37,143,965 (GRCm39) D131G probably damaging Het
Svep1 T C 4: 58,069,422 (GRCm39) Y2788C probably damaging Het
Tbl3 C A 17: 24,920,950 (GRCm39) probably null Het
Themis A T 10: 28,657,698 (GRCm39) I242L possibly damaging Het
Tmem203 G A 2: 25,145,742 (GRCm39) V21M probably benign Het
Trp53inp1 T C 4: 11,169,750 (GRCm39) C171R probably benign Het
Tsg101 A G 7: 46,563,159 (GRCm39) Y32H probably damaging Het
Tyw1 A G 5: 130,303,547 (GRCm39) D305G probably damaging Het
Vmn1r40 A T 6: 89,692,026 (GRCm39) Y281F probably damaging Het
Vmn2r105 T A 17: 20,447,937 (GRCm39) T296S probably damaging Het
Vmn2r13 T C 5: 109,319,557 (GRCm39) probably null Het
Zfp933 A G 4: 147,910,589 (GRCm39) F336L probably damaging Het
Other mutations in Hgfac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Hgfac APN 5 35,203,870 (GRCm39) missense probably damaging 1.00
IGL01999:Hgfac APN 5 35,202,155 (GRCm39) missense probably benign
IGL02133:Hgfac APN 5 35,203,931 (GRCm39) missense probably damaging 1.00
IGL02314:Hgfac APN 5 35,198,941 (GRCm39) start codon destroyed probably benign 0.21
IGL02337:Hgfac APN 5 35,199,722 (GRCm39) missense probably benign 0.00
IGL02405:Hgfac APN 5 35,201,824 (GRCm39) missense probably benign 0.19
IGL02451:Hgfac APN 5 35,201,158 (GRCm39) splice site probably null
IGL02508:Hgfac APN 5 35,204,564 (GRCm39) missense probably damaging 1.00
IGL02584:Hgfac APN 5 35,201,305 (GRCm39) unclassified probably benign
IGL02986:Hgfac APN 5 35,201,207 (GRCm39) missense probably benign 0.00
R0506:Hgfac UTSW 5 35,201,584 (GRCm39) missense probably damaging 1.00
R0664:Hgfac UTSW 5 35,205,522 (GRCm39) missense probably benign 0.34
R1733:Hgfac UTSW 5 35,201,018 (GRCm39) missense probably damaging 1.00
R1775:Hgfac UTSW 5 35,200,194 (GRCm39) unclassified probably benign
R1871:Hgfac UTSW 5 35,200,257 (GRCm39) makesense probably null
R3826:Hgfac UTSW 5 35,205,506 (GRCm39) missense probably damaging 1.00
R4553:Hgfac UTSW 5 35,200,200 (GRCm39) missense probably damaging 0.97
R5888:Hgfac UTSW 5 35,202,751 (GRCm39) missense probably damaging 1.00
R5905:Hgfac UTSW 5 35,199,706 (GRCm39) missense probably benign 0.20
R6017:Hgfac UTSW 5 35,201,739 (GRCm39) missense probably damaging 1.00
R6056:Hgfac UTSW 5 35,198,973 (GRCm39) nonsense probably null
R6124:Hgfac UTSW 5 35,201,728 (GRCm39) missense probably benign 0.06
R7059:Hgfac UTSW 5 35,201,773 (GRCm39) missense possibly damaging 0.49
R7232:Hgfac UTSW 5 35,204,258 (GRCm39) missense probably damaging 1.00
R8367:Hgfac UTSW 5 35,202,790 (GRCm39) missense probably damaging 1.00
R8371:Hgfac UTSW 5 35,202,787 (GRCm39) missense probably damaging 1.00
R9254:Hgfac UTSW 5 35,202,133 (GRCm39) missense probably damaging 1.00
R9730:Hgfac UTSW 5 35,204,282 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCCAAAGTGAGAGGTACC -3'
(R):5'- AGGATAAAACTGAGTCCCTGCCC -3'

Sequencing Primer
(F):5'- TCCTCCCTCCAGCAGCAG -3'
(R):5'- GAGCCCCACCCATCTCTG -3'
Posted On 2019-10-17