Incidental Mutation 'R7555:Grm3'
ID584683
Institutional Source Beutler Lab
Gene Symbol Grm3
Ensembl Gene ENSMUSG00000003974
Gene Nameglutamate receptor, metabotropic 3
SynonymsGprc1c, mGlu3, mGluR3, 0710001G23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7555 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location9485541-9725170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9570000 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 415 (T415A)
Ref Sequence ENSEMBL: ENSMUSP00000004076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004076]
Predicted Effect probably benign
Transcript: ENSMUST00000004076
AA Change: T415A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000004076
Gene: ENSMUSG00000003974
AA Change: T415A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 67 473 4.8e-102 PFAM
Pfam:NCD3G 505 555 2.4e-14 PFAM
Pfam:7tm_3 588 825 4.7e-62 PFAM
low complexity region 849 861 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display normal morphology, clinical chemistry, hematology, and behavior. Mice homozygous for a knock-out allele exhibit altered neuroprotection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T A 4: 144,522,354 I97N probably damaging Het
Acvrl1 A G 15: 101,143,473 H502R probably benign Het
Adgrf4 T C 17: 42,672,603 S63G probably benign Het
Agbl2 C A 2: 90,791,555 L129I probably damaging Het
Ankrd11 C A 8: 122,887,406 A2542S probably damaging Het
Armc9 A G 1: 86,275,678 K818R probably damaging Het
Arsj T A 3: 126,438,236 C210* probably null Het
Aspscr1 C T 11: 120,673,100 A11V unknown Het
Bicc1 G T 10: 70,956,291 Q296K possibly damaging Het
Borcs5 A C 6: 134,685,979 Q73P probably benign Het
Capn15 G T 17: 25,963,432 D567E probably damaging Het
Catsperg1 A C 7: 29,189,814 I866S probably damaging Het
Ccdc27 G T 4: 154,041,817 H72N unknown Het
Ccser2 A T 14: 36,879,500 M309K possibly damaging Het
Cd1d2 A G 3: 86,987,101 S59G probably benign Het
Chml G A 1: 175,687,890 P155L probably benign Het
Csmd2 C T 4: 128,452,458 P1504S Het
Dcbld2 A G 16: 58,448,718 probably null Het
Ddx21 C T 10: 62,598,243 E246K probably benign Het
Dhx29 C T 13: 112,927,642 probably benign Het
Dis3l A C 9: 64,311,937 Y570* probably null Het
Dnah14 T A 1: 181,770,054 Y3623N probably benign Het
Dock8 A G 19: 25,175,400 D1610G probably damaging Het
Dync1h1 T C 12: 110,630,625 S1669P probably benign Het
Eif2ak4 T A 2: 118,417,283 I267N possibly damaging Het
Ern2 A T 7: 122,170,241 V854E probably damaging Het
Fuca2 G A 10: 13,507,430 probably null Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gm1110 T A 9: 26,893,628 T380S probably benign Het
Gm13128 T C 4: 144,332,741 F341L probably benign Het
Gm5788 A C 12: 87,494,735 K5N unknown Het
Gm6460 A T 5: 11,597,612 N106Y probably damaging Het
Golga2 G A 2: 32,288,166 R29H probably benign Het
Grik5 T C 7: 25,060,597 E259G probably benign Het
Gtf3c1 A G 7: 125,645,670 Y1731H probably damaging Het
Hectd2 T C 19: 36,612,403 C643R probably damaging Het
Hgfac T C 5: 35,042,628 S118P probably damaging Het
Hmcn1 A G 1: 150,604,874 V4517A probably benign Het
Hnrnpc A T 14: 52,075,153 L290* probably null Het
Homer3 A G 8: 70,289,413 E108G probably damaging Het
Hsd17b3 G T 13: 64,072,002 S141R probably benign Het
Hspa12b C T 2: 131,138,476 T105I probably damaging Het
Ifi202b T C 1: 173,972,221 I231M probably damaging Het
Inhba T A 13: 16,017,637 N114K probably benign Het
Kmt2b C A 7: 30,569,410 M2631I possibly damaging Het
Loxhd1 C T 18: 77,395,365 T1214I probably damaging Het
Lrp1 G T 10: 127,546,862 N3683K probably damaging Het
Lrrc8e A G 8: 4,234,363 K196R probably benign Het
Lrrn3 A T 12: 41,452,911 M469K probably benign Het
Mafb T C 2: 160,365,829 E283G probably damaging Het
Mapt C A 11: 104,298,702 P182Q probably benign Het
Mmp14 G T 14: 54,437,742 R277L possibly damaging Het
Mucl2 T A 15: 103,897,445 N82I probably benign Het
Nsun6 T A 2: 14,996,339 T469S possibly damaging Het
Olfr1076 A C 2: 86,509,347 D296A probably damaging Het
Olfr1342 T C 4: 118,689,642 D270G possibly damaging Het
Olfr507 G C 7: 108,622,726 A305P probably damaging Het
Osbpl5 A T 7: 143,694,933 F631I possibly damaging Het
Otud3 G T 4: 138,901,885 D190E possibly damaging Het
Pcdhb6 A T 18: 37,335,279 I418F possibly damaging Het
Per1 G A 11: 69,106,513 R838H probably damaging Het
Per2 G A 1: 91,435,135 P395S probably damaging Het
Per3 G A 4: 151,018,058 Q583* probably null Het
Pkhd1l1 A T 15: 44,550,761 H2808L possibly damaging Het
Ppfia2 A G 10: 106,927,826 T1227A probably benign Het
Psg17 C T 7: 18,817,094 D279N probably benign Het
Rnf167 A G 11: 70,650,797 D235G probably benign Het
Rxfp3 A G 15: 11,036,276 S337P probably damaging Het
Sall1 T C 8: 89,033,158 D106G possibly damaging Het
Sema4f A G 6: 82,914,056 V590A probably benign Het
Setd1b A G 5: 123,157,757 D1102G unknown Het
Six2 C A 17: 85,687,707 K82N probably damaging Het
Snx29 T C 16: 11,400,942 M214T probably benign Het
Son T C 16: 91,658,922 L1519P probably damaging Het
Spin1 C T 13: 51,149,049 S226L probably benign Het
Stxbp5l T C 16: 37,323,603 D131G probably damaging Het
Svep1 T C 4: 58,069,422 Y2788C probably damaging Het
Tbl3 C A 17: 24,701,976 probably null Het
Themis A T 10: 28,781,702 I242L possibly damaging Het
Tmem203 G A 2: 25,255,730 V21M probably benign Het
Trp53inp1 T C 4: 11,169,750 C171R probably benign Het
Tsg101 A G 7: 46,913,411 Y32H probably damaging Het
Tyw1 A G 5: 130,274,706 D305G probably damaging Het
Vmn1r40 A T 6: 89,715,044 Y281F probably damaging Het
Vmn2r105 T A 17: 20,227,675 T296S probably damaging Het
Vmn2r13 T C 5: 109,171,691 probably null Het
Zfp933 A G 4: 147,826,132 F336L probably damaging Het
Other mutations in Grm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Grm3 APN 5 9512290 missense probably benign
IGL01393:Grm3 APN 5 9589856 missense probably benign 0.00
IGL01398:Grm3 APN 5 9485762 unclassified probably benign
IGL01825:Grm3 APN 5 9511600 missense probably damaging 1.00
IGL01966:Grm3 APN 5 9511486 missense probably damaging 0.98
IGL02367:Grm3 APN 5 9511660 missense probably damaging 1.00
IGL02526:Grm3 APN 5 9589847 missense probably damaging 1.00
IGL02972:Grm3 APN 5 9512410 missense probably damaging 1.00
IGL03356:Grm3 APN 5 9512206 missense possibly damaging 0.89
R0032:Grm3 UTSW 5 9511452 splice site probably null
R0032:Grm3 UTSW 5 9511452 splice site probably null
R0389:Grm3 UTSW 5 9504794 missense probably damaging 1.00
R0455:Grm3 UTSW 5 9512477 missense probably benign
R0538:Grm3 UTSW 5 9512446 missense possibly damaging 0.95
R0553:Grm3 UTSW 5 9570048 missense probably benign 0.16
R1124:Grm3 UTSW 5 9570297 missense probably benign
R1163:Grm3 UTSW 5 9570738 missense probably benign 0.34
R1440:Grm3 UTSW 5 9589958 missense probably benign
R1635:Grm3 UTSW 5 9511520 missense probably damaging 1.00
R1734:Grm3 UTSW 5 9589742 missense probably benign 0.00
R1895:Grm3 UTSW 5 9512123 missense probably damaging 1.00
R1926:Grm3 UTSW 5 9504881 missense probably damaging 0.98
R1940:Grm3 UTSW 5 9511682 missense probably damaging 1.00
R1946:Grm3 UTSW 5 9512123 missense probably damaging 1.00
R2004:Grm3 UTSW 5 9589793 missense possibly damaging 0.57
R2005:Grm3 UTSW 5 9589793 missense possibly damaging 0.57
R2006:Grm3 UTSW 5 9589793 missense possibly damaging 0.57
R3116:Grm3 UTSW 5 9570752 missense probably damaging 1.00
R4083:Grm3 UTSW 5 9512054 missense probably benign
R4537:Grm3 UTSW 5 9512083 missense probably benign 0.02
R4855:Grm3 UTSW 5 9570047 missense probably damaging 0.98
R5060:Grm3 UTSW 5 9570167 missense probably damaging 0.99
R5093:Grm3 UTSW 5 9589766 missense probably benign 0.01
R5419:Grm3 UTSW 5 9570233 missense probably damaging 1.00
R5525:Grm3 UTSW 5 9504872 missense probably damaging 1.00
R5642:Grm3 UTSW 5 9570536 missense probably benign 0.21
R5804:Grm3 UTSW 5 9570155 missense probably benign 0.33
R5915:Grm3 UTSW 5 9511927 missense probably damaging 1.00
R5966:Grm3 UTSW 5 9511930 missense probably damaging 0.98
R6151:Grm3 UTSW 5 9511556 missense probably damaging 1.00
R6419:Grm3 UTSW 5 9570201 missense probably damaging 1.00
R7267:Grm3 UTSW 5 9589581 missense probably benign 0.00
R7657:Grm3 UTSW 5 9511452 splice site probably null
X0020:Grm3 UTSW 5 9512195 missense probably damaging 1.00
X0025:Grm3 UTSW 5 9485790 missense probably damaging 1.00
X0026:Grm3 UTSW 5 9512238 nonsense probably null
Z1088:Grm3 UTSW 5 9570183 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGAGCCCTCCTTTTGTGTG -3'
(R):5'- TAACCCCTGGTTCCGAGACTTC -3'

Sequencing Primer
(F):5'- GTGGCTCTAAACTTCTAAAGCAAGG -3'
(R):5'- TTCTGGGAGCAGAAGTTCCAG -3'
Posted On2019-10-17