Incidental Mutation 'R7114:Ptprs'
ID551705
Institutional Source Beutler Lab
Gene Symbol Ptprs
Ensembl Gene ENSMUSG00000013236
Gene Nameprotein tyrosine phosphatase, receptor type, S
SynonymsPtpt9, PTP-NU3, RPTPsigma, PTPsigma
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7114 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location56412426-56476483 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 56451697 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 175 (V175L)
Ref Sequence ENSEMBL: ENSMUSP00000064048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067538] [ENSMUST00000086828] [ENSMUST00000223742] [ENSMUST00000223859]
PDB Structure
Crystal structure of mouse PTPsigma [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000067538
AA Change: V175L

PolyPhen 2 Score 0.400 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000064048
Gene: ENSMUSG00000013236
AA Change: V175L

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
IGc2 45 114 3.38e-10 SMART
IGc2 147 214 2.4e-15 SMART
IGc2 244 305 8.26e-5 SMART
FN3 319 398 2.8e-14 SMART
FN3 414 497 3.24e-10 SMART
FN3 512 590 3.17e-13 SMART
FN3 605 692 9.69e-9 SMART
FN3 707 796 2.42e-9 SMART
FN3 811 890 2.22e0 SMART
FN3 905 995 8.31e-8 SMART
FN3 1009 1085 3.22e-5 SMART
low complexity region 1164 1177 N/A INTRINSIC
transmembrane domain 1259 1281 N/A INTRINSIC
PTPc 1351 1609 1.54e-136 SMART
PTPc 1638 1900 3.12e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086828
AA Change: V175L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000084038
Gene: ENSMUSG00000013236
AA Change: V175L

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
IGc2 45 114 3.38e-10 SMART
IGc2 147 214 2.4e-15 SMART
IGc2 244 305 8.26e-5 SMART
FN3 319 398 2.8e-14 SMART
FN3 414 497 3.24e-10 SMART
FN3 512 590 3.17e-13 SMART
FN3 603 679 2.54e-3 SMART
low complexity region 758 771 N/A INTRINSIC
transmembrane domain 853 875 N/A INTRINSIC
PTPc 945 1203 1.54e-136 SMART
PTPc 1232 1494 3.12e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223742
Predicted Effect probably benign
Transcript: ENSMUST00000223859
AA Change: V175L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1593 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of multiple Ig-like and fibronectin type III-like domains. Studies of the similar gene in mice suggested that this PTP may be involved in cell-cell interaction, primary axonogenesis, and axon guidance during embryogenesis. This PTP has been also implicated in the molecular control of adult nerve repair. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Almost half of null homozygotes die in the first day of life. Embryos are characterized by decreased brain size including small pituitary glands and small olfactory bulbs. Adult mice are small, lack estrus, have decreased litter sizes and have impairedolfaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,009,619 A1291T probably benign Het
Anks1b G A 10: 90,307,698 R523Q probably damaging Het
Arhgap12 T A 18: 6,028,056 I690F probably damaging Het
Caln1 T C 5: 130,839,283 V220A possibly damaging Het
Cd79b T A 11: 106,311,887 T263S probably damaging Het
Cep290 A T 10: 100,543,358 K67N probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Col25a1 A G 3: 130,595,675 I636V probably benign Het
Col9a3 C T 2: 180,603,797 P154S unknown Het
Cyp3a11 T A 5: 145,858,783 M453L probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Eno1b T C 18: 48,047,493 V246A possibly damaging Het
Eogt T C 6: 97,116,004 Y404C probably damaging Het
Ephx3 T A 17: 32,185,032 E380V possibly damaging Het
Fancl T C 11: 26,407,615 L114P probably damaging Het
Flad1 C T 3: 89,407,530 G287S probably benign Het
Gcm1 G T 9: 78,059,779 K93N probably damaging Het
Golga3 T A 5: 110,202,712 D704E probably benign Het
Grb14 A C 2: 64,916,853 I451S probably damaging Het
Gtf3c3 T C 1: 54,423,507 N366D probably benign Het
Hecw1 A T 13: 14,311,771 H376Q probably benign Het
Helb A T 10: 120,105,256 V509E probably benign Het
Hephl1 C T 9: 15,069,815 E774K probably damaging Het
Hkdc1 T C 10: 62,393,843 E685G probably damaging Het
Igfn1 T C 1: 135,966,781 T2016A probably benign Het
Igkv5-43 T G 6: 69,823,531 Q57H probably damaging Het
Lamc3 T A 2: 31,930,645 V1224E probably damaging Het
Lgals3bp C T 11: 118,393,483 W423* probably null Het
Mcm9 G A 10: 53,538,573 T137I possibly damaging Het
Mdga1 C A 17: 29,842,842 probably null Het
Mocos C T 18: 24,666,515 P269S probably damaging Het
Naa40 A G 19: 7,229,957 V134A probably damaging Het
Neb G A 2: 52,192,559 L5680F probably damaging Het
Nedd9 A G 13: 41,338,623 V137A probably benign Het
Nup133 T C 8: 123,915,373 I784V probably benign Het
Nup214 T C 2: 32,025,244 S1147P possibly damaging Het
Olfr248 A T 1: 174,391,239 M57L probably damaging Het
Olfr945 G T 9: 39,258,601 Q24K possibly damaging Het
Plcb4 T A 2: 135,982,123 probably null Het
Pomt1 C T 2: 32,253,836 T671I probably benign Het
Pomt2 G T 12: 87,110,376 P723H probably damaging Het
Prpf8 T A 11: 75,503,355 Y1741* probably null Het
Slc36a4 T C 9: 15,721,954 F95L probably benign Het
Smn1 C T 13: 100,131,140 P225S probably benign Het
Snrpa A T 7: 27,191,749 I99N probably benign Het
Tgm5 G T 2: 121,048,496 Y588* probably null Het
Tmeff2 T A 1: 51,185,245 probably null Het
Tmem120b T C 5: 123,116,678 F314S probably damaging Het
Trim43b C T 9: 89,085,608 R325H probably benign Het
Vmn1r26 C T 6: 58,008,770 A145T probably benign Het
Wdfy4 T C 14: 32,971,574 probably null Het
Wnt5a C A 14: 28,522,756 T320K probably damaging Het
Wrn AGCAGGTAATACATACCG AG 8: 33,285,121 probably null Het
Zfp398 T C 6: 47,865,976 S321P probably benign Het
Zfp959 T A 17: 55,898,501 C513S possibly damaging Het
Zfr2 A G 10: 81,244,725 D411G probably damaging Het
Zkscan5 T A 5: 145,211,178 probably benign Het
Other mutations in Ptprs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Ptprs APN 17 56458243 missense probably damaging 0.99
IGL01388:Ptprs APN 17 56421261 missense probably damaging 1.00
IGL01568:Ptprs APN 17 56413958 missense probably damaging 1.00
IGL01781:Ptprs APN 17 56435676 missense probably damaging 1.00
IGL02499:Ptprs APN 17 56437884 missense probably damaging 1.00
IGL02576:Ptprs APN 17 56414958 missense probably damaging 1.00
IGL02736:Ptprs APN 17 56458248 missense possibly damaging 0.88
IGL02871:Ptprs APN 17 56447443 missense probably damaging 1.00
IGL02946:Ptprs APN 17 56424032 missense probably benign
IGL03061:Ptprs APN 17 56418830 missense probably damaging 0.96
IGL03347:Ptprs APN 17 56435972 missense probably benign 0.07
IGL03351:Ptprs APN 17 56437943 missense probably damaging 1.00
P0019:Ptprs UTSW 17 56447474 splice site probably benign
PIT4434001:Ptprs UTSW 17 56454984 missense probably null 0.02
PIT4520001:Ptprs UTSW 17 56414980 missense probably damaging 1.00
R0240:Ptprs UTSW 17 56436087 unclassified probably null
R0240:Ptprs UTSW 17 56436087 unclassified probably null
R0504:Ptprs UTSW 17 56454220 missense possibly damaging 0.60
R0518:Ptprs UTSW 17 56419621 critical splice donor site probably null
R0539:Ptprs UTSW 17 56458255 missense probably damaging 0.97
R0620:Ptprs UTSW 17 56429103 missense possibly damaging 0.93
R0683:Ptprs UTSW 17 56414086 missense probably damaging 1.00
R1147:Ptprs UTSW 17 56423504 missense probably damaging 1.00
R1147:Ptprs UTSW 17 56423504 missense probably damaging 1.00
R1474:Ptprs UTSW 17 56424128 missense probably damaging 0.98
R1502:Ptprs UTSW 17 56437992 missense probably benign 0.00
R1817:Ptprs UTSW 17 56419527 missense probably damaging 1.00
R1844:Ptprs UTSW 17 56434510 missense probably damaging 1.00
R2077:Ptprs UTSW 17 56434990 missense probably null 0.26
R2086:Ptprs UTSW 17 56454984 missense probably null 0.02
R2149:Ptprs UTSW 17 56417706 missense probably damaging 1.00
R3618:Ptprs UTSW 17 56428965 missense probably benign 0.25
R3722:Ptprs UTSW 17 56417485 missense probably damaging 1.00
R3771:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R3772:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R3773:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R4032:Ptprs UTSW 17 56413386 missense probably damaging 1.00
R4326:Ptprs UTSW 17 56447468 missense possibly damaging 0.83
R4327:Ptprs UTSW 17 56447468 missense possibly damaging 0.83
R4480:Ptprs UTSW 17 56426404 missense possibly damaging 0.79
R4505:Ptprs UTSW 17 56451678 missense possibly damaging 0.57
R4507:Ptprs UTSW 17 56419014 missense probably damaging 1.00
R4588:Ptprs UTSW 17 56425534 missense probably damaging 1.00
R4662:Ptprs UTSW 17 56417666 missense probably damaging 1.00
R4708:Ptprs UTSW 17 56428067 missense probably damaging 1.00
R5016:Ptprs UTSW 17 56419070 missense probably damaging 1.00
R5416:Ptprs UTSW 17 56435724 missense probably damaging 1.00
R5447:Ptprs UTSW 17 56429128 missense possibly damaging 0.50
R6041:Ptprs UTSW 17 56419080 missense probably benign 0.00
R6329:Ptprs UTSW 17 56417427 nonsense probably null
R6377:Ptprs UTSW 17 56418935 missense probably damaging 1.00
R6605:Ptprs UTSW 17 56422195 missense probably damaging 1.00
R6749:Ptprs UTSW 17 56437884 missense probably damaging 1.00
R7113:Ptprs UTSW 17 56451697 missense probably benign 0.40
R7133:Ptprs UTSW 17 56417429 missense probably damaging 1.00
R7220:Ptprs UTSW 17 56418988 missense probably benign 0.29
R7423:Ptprs UTSW 17 56414793 missense probably damaging 1.00
R7440:Ptprs UTSW 17 56424256 missense possibly damaging 0.75
R7457:Ptprs UTSW 17 56419502 missense probably damaging 0.99
R7574:Ptprs UTSW 17 56423538 missense probably benign 0.00
R7851:Ptprs UTSW 17 56425482 missense probably benign
R7903:Ptprs UTSW 17 56424960 nonsense probably null
R8013:Ptprs UTSW 17 56435994 missense probably damaging 1.00
R8014:Ptprs UTSW 17 56435994 missense probably damaging 1.00
R8094:Ptprs UTSW 17 56428947 missense probably benign 0.01
R8112:Ptprs UTSW 17 56434532 nonsense probably null
R8181:Ptprs UTSW 17 56429064 missense probably damaging 1.00
RF014:Ptprs UTSW 17 56416935 missense probably damaging 1.00
X0028:Ptprs UTSW 17 56437831 missense probably damaging 1.00
Z1176:Ptprs UTSW 17 56417050 missense possibly damaging 0.82
Z1176:Ptprs UTSW 17 56422211 nonsense probably null
Z1176:Ptprs UTSW 17 56434468 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CAGCTCTCTACGTTTTGGGTGC -3'
(R):5'- CAGTCACTGAGGGCATTTGC -3'

Sequencing Primer
(F):5'- CTACGTTTTGGGTGCAGGGC -3'
(R):5'- GCATTTGCCGCAATAACTGG -3'
Posted On2019-05-15