Incidental Mutation 'R0622:Phldb1'
ID 58737
Institutional Source Beutler Lab
Gene Symbol Phldb1
Ensembl Gene ENSMUSG00000048537
Gene Name pleckstrin homology like domain, family B, member 1
Synonyms D330037A14Rik, LL5A
MMRRC Submission 038811-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.104) question?
Stock # R0622 (G1)
Quality Score 184
Status Not validated
Chromosome 9
Chromosomal Location 44597601-44646495 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44627149 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 432 (D432G)
Ref Sequence ENSEMBL: ENSMUSP00000120208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034611] [ENSMUST00000123406] [ENSMUST00000134465] [ENSMUST00000138356] [ENSMUST00000147495] [ENSMUST00000154723] [ENSMUST00000144251] [ENSMUST00000148929] [ENSMUST00000156918]
AlphaFold Q6PDH0
Predicted Effect possibly damaging
Transcript: ENSMUST00000034611
AA Change: D432G

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034611
Gene: ENSMUSG00000048537
AA Change: D432G

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 3e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 5.01e-5 PROSPERO
internal_repeat_1 401 449 5.01e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 943 961 N/A INTRINSIC
low complexity region 976 997 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
low complexity region 1103 1111 N/A INTRINSIC
coiled coil region 1150 1219 N/A INTRINSIC
PH 1262 1366 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123406
SMART Domains Protein: ENSMUSP00000114257
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
low complexity region 132 153 N/A INTRINSIC
low complexity region 176 196 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126818
Predicted Effect probably benign
Transcript: ENSMUST00000128326
SMART Domains Protein: ENSMUSP00000119966
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
low complexity region 187 200 N/A INTRINSIC
coiled coil region 207 290 N/A INTRINSIC
low complexity region 312 322 N/A INTRINSIC
coiled coil region 357 396 N/A INTRINSIC
low complexity region 422 443 N/A INTRINSIC
low complexity region 493 506 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 564 572 N/A INTRINSIC
coiled coil region 610 679 N/A INTRINSIC
PH 723 827 1.31e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134465
AA Change: D432G

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117395
Gene: ENSMUSG00000048537
AA Change: D432G

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 3e-10 PDB
Blast:FHA 63 110 8e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 6.75e-5 PROSPERO
internal_repeat_1 401 449 6.75e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 929 950 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
low complexity region 1056 1064 N/A INTRINSIC
coiled coil region 1103 1172 N/A INTRINSIC
PH 1215 1319 1.31e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000138356
AA Change: D432G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120208
Gene: ENSMUSG00000048537
AA Change: D432G

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 4e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 4.93e-5 PROSPERO
internal_repeat_1 401 449 4.93e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 931 948 N/A INTRINSIC
low complexity region 999 1017 N/A INTRINSIC
low complexity region 1032 1053 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
low complexity region 1159 1167 N/A INTRINSIC
coiled coil region 1206 1286 N/A INTRINSIC
PH 1329 1444 6.01e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000147495
AA Change: D432G

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122661
Gene: ENSMUSG00000048537
AA Change: D432G

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 4e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 5e-5 PROSPERO
internal_repeat_1 401 449 5e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 943 961 N/A INTRINSIC
low complexity region 976 997 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
low complexity region 1103 1111 N/A INTRINSIC
coiled coil region 1150 1219 N/A INTRINSIC
PH 1262 1377 6.01e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000148344
AA Change: D176G
SMART Domains Protein: ENSMUSP00000121809
Gene: ENSMUSG00000048537
AA Change: D176G

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 41 61 N/A INTRINSIC
internal_repeat_1 66 99 6.7e-6 PROSPERO
internal_repeat_1 146 194 6.7e-6 PROSPERO
low complexity region 204 222 N/A INTRINSIC
low complexity region 335 362 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
coiled coil region 459 542 N/A INTRINSIC
low complexity region 564 574 N/A INTRINSIC
coiled coil region 609 648 N/A INTRINSIC
low complexity region 688 706 N/A INTRINSIC
low complexity region 721 742 N/A INTRINSIC
low complexity region 792 805 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 863 871 N/A INTRINSIC
coiled coil region 909 978 N/A INTRINSIC
PH 1022 1126 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154723
SMART Domains Protein: ENSMUSP00000116987
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
coiled coil region 39 67 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
coiled coil region 118 157 N/A INTRINSIC
low complexity region 197 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144251
SMART Domains Protein: ENSMUSP00000114773
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
coiled coil region 32 115 N/A INTRINSIC
coiled coil region 146 174 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
coiled coil region 225 264 N/A INTRINSIC
low complexity region 289 310 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
low complexity region 416 424 N/A INTRINSIC
coiled coil region 463 532 N/A INTRINSIC
PH 575 679 1.31e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214717
Predicted Effect probably benign
Transcript: ENSMUST00000148929
SMART Domains Protein: ENSMUSP00000114533
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
low complexity region 132 153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156918
SMART Domains Protein: ENSMUSP00000120092
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
coiled coil region 32 115 N/A INTRINSIC
low complexity region 136 146 N/A INTRINSIC
coiled coil region 182 221 N/A INTRINSIC
low complexity region 246 267 N/A INTRINSIC
low complexity region 325 339 N/A INTRINSIC
low complexity region 373 381 N/A INTRINSIC
coiled coil region 420 489 N/A INTRINSIC
PH 532 636 1.31e-17 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a T A 13: 30,565,664 (GRCm39) M243K probably benign Het
Ap1b1 A G 11: 4,987,707 (GRCm39) M744V probably damaging Het
Ccdc152 T C 15: 3,327,660 (GRCm39) N39S probably damaging Het
Cd163 G A 6: 124,294,311 (GRCm39) V490M probably damaging Het
Col6a5 G T 9: 105,803,051 (GRCm39) H1305N unknown Het
Cpb1 C A 3: 20,303,982 (GRCm39) D361Y probably damaging Het
Dchs1 T A 7: 105,412,656 (GRCm39) Y1248F probably damaging Het
Dhdds G C 4: 133,721,547 (GRCm39) F83L probably damaging Het
Dsg4 T A 18: 20,582,845 (GRCm39) V161E possibly damaging Het
Exosc4 A G 15: 76,211,736 (GRCm39) D15G probably damaging Het
F3 A T 3: 121,518,668 (GRCm39) D44V probably damaging Het
Fat2 A T 11: 55,173,954 (GRCm39) F2253Y probably damaging Het
Fbn1 T C 2: 125,220,944 (GRCm39) D650G possibly damaging Het
Gramd4 T A 15: 85,975,590 (GRCm39) F36I probably damaging Het
Grm7 G A 6: 111,335,457 (GRCm39) A623T probably damaging Het
Gys1 A T 7: 45,089,419 (GRCm39) T193S probably damaging Het
Hectd4 A G 5: 121,486,688 (GRCm39) T3228A possibly damaging Het
Itpk1 G T 12: 102,540,239 (GRCm39) D281E probably damaging Het
Kcnh7 A C 2: 62,667,633 (GRCm39) probably null Het
Klhl29 A G 12: 5,131,224 (GRCm39) L852P probably damaging Het
Lrch1 T C 14: 75,033,491 (GRCm39) Y509C probably benign Het
Lrp1b A G 2: 41,618,563 (GRCm39) probably null Het
Mcpt4 C A 14: 56,298,119 (GRCm39) R144L probably benign Het
Mia2 C T 12: 59,178,364 (GRCm39) R12W probably damaging Het
Mrps5 A G 2: 127,436,451 (GRCm39) K116R probably benign Het
Myrf G A 19: 10,200,816 (GRCm39) P286S probably damaging Het
Nanp A G 2: 150,881,164 (GRCm39) M28T probably benign Het
Neb T C 2: 52,102,963 (GRCm39) I4472V probably benign Het
Nfix A C 8: 85,453,111 (GRCm39) N314K probably damaging Het
Nlrc3 C T 16: 3,771,832 (GRCm39) R849Q probably benign Het
Nup210l G A 3: 90,075,047 (GRCm39) V786M probably damaging Het
Or2t44 T C 11: 58,677,167 (GRCm39) S36P probably damaging Het
Or52ad1 A G 7: 102,996,064 (GRCm39) S24P probably damaging Het
Or6z5 T C 7: 6,477,598 (GRCm39) I163T possibly damaging Het
Or8c20 A G 9: 38,260,667 (GRCm39) N96S possibly damaging Het
Pdia4 A T 6: 47,783,452 (GRCm39) F197Y probably damaging Het
Pik3ca A G 3: 32,490,701 (GRCm39) E116G probably damaging Het
Polq T C 16: 36,881,355 (GRCm39) V1173A probably benign Het
Pou2f3 C T 9: 43,036,414 (GRCm39) R423H probably damaging Het
Pramel29 T C 4: 143,939,583 (GRCm39) probably benign Het
Prkag2 T C 5: 25,074,247 (GRCm39) N246S probably damaging Het
Proser1 A G 3: 53,385,281 (GRCm39) S388G probably benign Het
Ralgps1 G A 2: 33,064,459 (GRCm39) R238* probably null Het
Rfx2 T C 17: 57,084,071 (GRCm39) D657G probably damaging Het
Ryr3 A G 2: 112,492,900 (GRCm39) F3724S probably damaging Het
Sh2d5 T C 4: 137,986,539 (GRCm39) S421P probably damaging Het
Slc34a1 C A 13: 23,996,594 (GRCm39) T33K probably damaging Het
St8sia5 A G 18: 77,333,809 (GRCm39) T156A probably damaging Het
Stk32c T C 7: 138,768,026 (GRCm39) D85G probably benign Het
Tnks A G 8: 35,407,976 (GRCm39) S251P probably damaging Het
Tnxb T A 17: 34,937,703 (GRCm39) L3864Q probably damaging Het
Trim9 A G 12: 70,393,378 (GRCm39) Y189H probably damaging Het
Vmn1r77 T G 7: 11,775,315 (GRCm39) F30L probably benign Het
Wasf3 A G 5: 146,403,602 (GRCm39) probably null Het
Wdr90 C T 17: 26,074,632 (GRCm39) C603Y probably damaging Het
Zdhhc25 T C 15: 88,485,310 (GRCm39) L215P probably damaging Het
Zeb1 C T 18: 5,759,123 (GRCm39) Q140* probably null Het
Zfp677 C T 17: 21,617,962 (GRCm39) L340F probably benign Het
Other mutations in Phldb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Phldb1 APN 9 44,622,443 (GRCm39) critical splice donor site probably null
IGL01089:Phldb1 APN 9 44,619,184 (GRCm39) nonsense probably null
IGL01374:Phldb1 APN 9 44,607,464 (GRCm39) missense probably damaging 0.98
IGL01654:Phldb1 APN 9 44,629,654 (GRCm39) splice site probably null
IGL02148:Phldb1 APN 9 44,607,369 (GRCm39) missense probably damaging 0.99
IGL02408:Phldb1 APN 9 44,627,203 (GRCm39) missense possibly damaging 0.50
IGL02429:Phldb1 APN 9 44,612,247 (GRCm39) missense probably damaging 1.00
IGL02440:Phldb1 APN 9 44,626,700 (GRCm39) missense probably damaging 0.99
IGL02457:Phldb1 APN 9 44,627,771 (GRCm39) missense probably benign 0.00
IGL02471:Phldb1 APN 9 44,622,530 (GRCm39) missense probably damaging 1.00
IGL02506:Phldb1 APN 9 44,622,223 (GRCm39) missense probably benign 0.00
IGL03335:Phldb1 APN 9 44,639,366 (GRCm39) missense possibly damaging 0.95
PIT4515001:Phldb1 UTSW 9 44,627,257 (GRCm39) missense probably benign 0.00
R0070:Phldb1 UTSW 9 44,619,201 (GRCm39) missense probably damaging 1.00
R0117:Phldb1 UTSW 9 44,623,003 (GRCm39) start codon destroyed probably null
R0344:Phldb1 UTSW 9 44,612,964 (GRCm39) missense probably benign 0.14
R0364:Phldb1 UTSW 9 44,610,632 (GRCm39) splice site probably benign
R0737:Phldb1 UTSW 9 44,610,933 (GRCm39) missense possibly damaging 0.92
R1449:Phldb1 UTSW 9 44,627,930 (GRCm39) missense probably benign 0.17
R1498:Phldb1 UTSW 9 44,612,915 (GRCm39) missense possibly damaging 0.70
R1633:Phldb1 UTSW 9 44,629,619 (GRCm39) missense probably damaging 1.00
R1647:Phldb1 UTSW 9 44,626,730 (GRCm39) missense probably damaging 1.00
R1692:Phldb1 UTSW 9 44,626,717 (GRCm39) missense probably damaging 1.00
R1749:Phldb1 UTSW 9 44,627,045 (GRCm39) missense probably damaging 1.00
R1797:Phldb1 UTSW 9 44,627,842 (GRCm39) missense probably damaging 0.99
R2012:Phldb1 UTSW 9 44,639,333 (GRCm39) missense possibly damaging 0.67
R2078:Phldb1 UTSW 9 44,619,276 (GRCm39) missense probably damaging 1.00
R2208:Phldb1 UTSW 9 44,607,428 (GRCm39) missense probably damaging 1.00
R2567:Phldb1 UTSW 9 44,637,322 (GRCm39) missense probably damaging 0.99
R2696:Phldb1 UTSW 9 44,629,585 (GRCm39) missense probably damaging 1.00
R3705:Phldb1 UTSW 9 44,605,691 (GRCm39) missense probably damaging 0.97
R4110:Phldb1 UTSW 9 44,627,128 (GRCm39) missense possibly damaging 0.88
R4772:Phldb1 UTSW 9 44,622,324 (GRCm39) missense probably damaging 1.00
R4857:Phldb1 UTSW 9 44,607,389 (GRCm39) missense probably damaging 0.99
R5148:Phldb1 UTSW 9 44,615,455 (GRCm39) missense probably benign 0.04
R5651:Phldb1 UTSW 9 44,623,200 (GRCm39) missense probably damaging 1.00
R5666:Phldb1 UTSW 9 44,627,078 (GRCm39) missense probably damaging 0.97
R5670:Phldb1 UTSW 9 44,627,078 (GRCm39) missense probably damaging 0.97
R5914:Phldb1 UTSW 9 44,622,948 (GRCm39) missense probably damaging 0.97
R6232:Phldb1 UTSW 9 44,607,414 (GRCm39) missense probably damaging 1.00
R6257:Phldb1 UTSW 9 44,607,437 (GRCm39) missense probably damaging 0.99
R6413:Phldb1 UTSW 9 44,607,440 (GRCm39) missense probably damaging 1.00
R6418:Phldb1 UTSW 9 44,623,197 (GRCm39) missense probably damaging 1.00
R6813:Phldb1 UTSW 9 44,610,865 (GRCm39) missense probably damaging 1.00
R6845:Phldb1 UTSW 9 44,627,359 (GRCm39) missense probably damaging 1.00
R7009:Phldb1 UTSW 9 44,605,705 (GRCm39) missense probably damaging 1.00
R7042:Phldb1 UTSW 9 44,605,721 (GRCm39) missense probably damaging 1.00
R7062:Phldb1 UTSW 9 44,607,432 (GRCm39) missense probably damaging 0.99
R7077:Phldb1 UTSW 9 44,623,201 (GRCm39) missense possibly damaging 0.62
R7307:Phldb1 UTSW 9 44,605,344 (GRCm39) missense possibly damaging 0.62
R7995:Phldb1 UTSW 9 44,626,669 (GRCm39) missense probably damaging 1.00
R8108:Phldb1 UTSW 9 44,622,458 (GRCm39) missense probably damaging 1.00
R8433:Phldb1 UTSW 9 44,627,759 (GRCm39) missense probably damaging 1.00
R9151:Phldb1 UTSW 9 44,619,740 (GRCm39) missense probably null 0.01
R9366:Phldb1 UTSW 9 44,622,546 (GRCm39) missense possibly damaging 0.93
R9378:Phldb1 UTSW 9 44,615,425 (GRCm39) missense probably benign 0.01
R9448:Phldb1 UTSW 9 44,622,546 (GRCm39) missense possibly damaging 0.93
R9539:Phldb1 UTSW 9 44,627,482 (GRCm39) missense probably damaging 1.00
R9641:Phldb1 UTSW 9 44,627,839 (GRCm39) missense probably damaging 1.00
RF020:Phldb1 UTSW 9 44,609,243 (GRCm39) missense probably damaging 1.00
X0020:Phldb1 UTSW 9 44,598,974 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAAGTTCGTCCTCATTGTCGC -3'
(R):5'- AGTATTCCTGGCAGCCCCAAGTTC -3'

Sequencing Primer
(F):5'- GAAGTCCTCAGGTGAAGTCC -3'
(R):5'- AAGTTCCAGTCTCCAGTGC -3'
Posted On 2013-07-11