Incidental Mutation 'R3933:Sp100'
ID308537
Institutional Source Beutler Lab
Gene Symbol Sp100
Ensembl Gene ENSMUSG00000026222
Gene Namenuclear antigen Sp100
Synonyms
MMRRC Submission 040920-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R3933 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location85649988-85709998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85681109 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 320 (I320V)
Ref Sequence ENSEMBL: ENSMUSP00000118481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054279] [ENSMUST00000066427] [ENSMUST00000145440] [ENSMUST00000147552] [ENSMUST00000150967] [ENSMUST00000153574] [ENSMUST00000155094]
Predicted Effect probably benign
Transcript: ENSMUST00000054279
AA Change: I320V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051705
Gene: ENSMUSG00000026222
AA Change: I320V

DomainStartEndE-ValueType
Pfam:Sp100 19 122 4.9e-47 PFAM
low complexity region 334 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066427
AA Change: I320V

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000066399
Gene: ENSMUSG00000026222
AA Change: I320V

DomainStartEndE-ValueType
Pfam:Sp100 21 119 3.4e-40 PFAM
low complexity region 320 335 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
SAND 386 459 8.85e-38 SMART
BROMO 473 573 1.16e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140758
Predicted Effect probably benign
Transcript: ENSMUST00000145440
SMART Domains Protein: ENSMUSP00000120604
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 3.7e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147552
SMART Domains Protein: ENSMUSP00000116942
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 2.5e-46 PFAM
low complexity region 305 319 N/A INTRINSIC
low complexity region 349 359 N/A INTRINSIC
SAND 368 441 8.85e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150967
SMART Domains Protein: ENSMUSP00000122899
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 2.1e-46 PFAM
low complexity region 324 334 N/A INTRINSIC
SAND 343 416 8.85e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153574
AA Change: I320V

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122670
Gene: ENSMUSG00000026222
AA Change: I320V

DomainStartEndE-ValueType
Pfam:Sp100 19 122 9.2e-47 PFAM
low complexity region 342 352 N/A INTRINSIC
SAND 361 434 8.85e-38 SMART
Blast:BROMO 453 476 9e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000155094
AA Change: I320V

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118481
Gene: ENSMUSG00000026222
AA Change: I320V

DomainStartEndE-ValueType
Pfam:Sp100 19 122 1.6e-46 PFAM
low complexity region 320 335 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
SAND 386 459 8.85e-38 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 96% (43/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,354,856 F3350L probably damaging Het
Acp6 T C 3: 97,166,183 V146A probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Arhgef33 A G 17: 80,373,320 I630V probably benign Het
Astn2 G A 4: 66,403,955 R136C unknown Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
C1rl T A 6: 124,508,822 L384* probably null Het
Ccdc130 G A 8: 84,260,352 A172V probably benign Het
Ccdc6 TCCGCCGCCGCC TCCGCCGCC 10: 70,189,170 probably benign Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ercc5 T A 1: 44,167,856 M643K probably benign Het
Fut8 A C 12: 77,475,259 K557N probably damaging Het
Hsdl2 T C 4: 59,597,274 Y88H probably damaging Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Itga8 A G 2: 12,189,519 I690T probably benign Het
Lepr T C 4: 101,765,301 probably benign Het
Matn2 T C 15: 34,345,420 probably null Het
Mei1 A G 15: 82,083,152 K310E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Ogdh T C 11: 6,342,601 V438A possibly damaging Het
Olfr1109 T A 2: 87,092,762 I212F probably benign Het
Olfr1293-ps T C 2: 111,527,955 Y232H probably damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Parp2 G A 14: 50,819,387 V323M probably benign Het
Pip5k1a A G 3: 95,072,003 S161P probably benign Het
Pold3 T C 7: 100,121,401 E8G probably damaging Het
Pomt1 G A 2: 32,245,619 V332I probably benign Het
Ppp2ca T A 11: 52,119,262 N232K probably damaging Het
Prune2 A T 19: 17,123,954 D2274V probably damaging Het
Pwwp2b G A 7: 139,256,034 V464I possibly damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rubcn A G 16: 32,829,259 probably null Het
Scai A T 2: 39,075,052 D593E probably benign Het
Slc24a2 T C 4: 87,176,185 T366A probably benign Het
Syngr2 C A 11: 117,813,417 P206Q probably damaging Het
Tatdn3 A T 1: 191,046,324 probably null Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r11 C T 5: 109,053,394 A415T probably damaging Het
Vmn2r88 A G 14: 51,413,978 M258V probably benign Het
Wiz G A 17: 32,357,898 R561C probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Other mutations in Sp100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Sp100 APN 1 85670020 missense possibly damaging 0.48
IGL01998:Sp100 APN 1 85666929 missense probably benign 0.01
IGL02192:Sp100 APN 1 85708001 missense probably damaging 0.99
IGL02809:Sp100 APN 1 85681124 missense probably damaging 0.99
IGL03274:Sp100 APN 1 85707304 intron probably benign
PIT4458001:Sp100 UTSW 1 85708116 missense probably benign 0.10
R0115:Sp100 UTSW 1 85650131 splice site probably benign
R0599:Sp100 UTSW 1 85681110 missense possibly damaging 0.68
R0620:Sp100 UTSW 1 85659867 splice site probably null
R0693:Sp100 UTSW 1 85667005 critical splice donor site probably null
R0709:Sp100 UTSW 1 85694281 missense probably damaging 0.96
R0744:Sp100 UTSW 1 85699744 missense probably damaging 0.97
R0836:Sp100 UTSW 1 85699744 missense probably damaging 0.97
R1175:Sp100 UTSW 1 85701420 missense possibly damaging 0.83
R1496:Sp100 UTSW 1 85663521 splice site probably benign
R1749:Sp100 UTSW 1 85699636 missense possibly damaging 0.95
R2046:Sp100 UTSW 1 85709065 missense possibly damaging 0.53
R2069:Sp100 UTSW 1 85681142 splice site probably null
R2441:Sp100 UTSW 1 85703489 unclassified probably benign
R4171:Sp100 UTSW 1 85706841 missense probably benign 0.00
R4762:Sp100 UTSW 1 85701458 makesense probably null
R4863:Sp100 UTSW 1 85705003 missense probably benign 0.03
R5156:Sp100 UTSW 1 85673683 missense probably damaging 1.00
R5273:Sp100 UTSW 1 85709104 missense possibly damaging 0.86
R5635:Sp100 UTSW 1 85682264 intron probably benign
R5810:Sp100 UTSW 1 85665285 missense probably benign 0.12
R5910:Sp100 UTSW 1 85681140 critical splice donor site probably null
R5931:Sp100 UTSW 1 85679083 missense probably damaging 1.00
R7466:Sp100 UTSW 1 85707239 missense possibly damaging 0.93
R7514:Sp100 UTSW 1 85681139 nonsense probably null
R7647:Sp100 UTSW 1 85692043 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TATGCCAGACCCATCAGTCC -3'
(R):5'- TTAAGACCTCAGGGCCCTAG -3'

Sequencing Primer
(F):5'- CAGTCCCTACATATTGAATTCGTGGG -3'
(R):5'- GCCCTAGACGATCATGTGGAAC -3'
Posted On2015-04-17