Mutagenetix > Incidental Mutations

Incidental Mutation 'R7671:Slc35a1'

592150

Institutional Source

Beutler Lab

Gene Symbol

Slc35a1

Ensembl Gene

ENSMUSG00000028293

Gene Name

solute carrier family 35 (CMP-sialic acid transporter), member 1

Synonyms

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7671 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34663257-34687438 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 34673875 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 150 (H150Q)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029970]

Predicted Effect

probably benign
Transcript: ENSMUST00000029970

SMART Domains

Protein: ENSMUSP00000029970
Gene: ENSMUSG00000028293

Domain	Start	End	E-Value	Type
Pfam:Nuc_sug_transp	8	314	6.4e-125	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000119125
Gene: ENSMUSG00000028293
AA Change: H150Q

Domain	Start	End	E-Value	Type
Pfam:Nuc_sug_transp	1	250	1.2e-86	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the membrane of the Golgi apparatus, where it transports nucleotide sugars into the Golgi. One such nucleotide sugar is CMP-sialic acid, which is imported into the Golgi by the encoded protein and subsequently glycosylated. Defects in this gene are a cause of congenital disorder of glycosylation type 2F (CDG2F). Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous mutation of this gene results in lethality before weaning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	A	18: 38,259,925	I394N	probably damaging	Het
4930435E12Rik	C	T	16: 38,828,091	D219N	possibly damaging	Het
4932438A13Rik	T	C	3: 36,943,231	F1146L	probably damaging	Het
4933406M09Rik	T	C	1: 134,390,062	C191R	probably benign	Het
Akap13	C	A	7: 75,569,900	T17K	probably damaging	Het
Ankrd29	T	A	18: 12,260,986	K257I	probably damaging	Het
Bicc1	A	G	10: 70,957,167	L219P	probably benign	Het
Boc	C	T	16: 44,491,849	V617M		Het
Ccl8	A	G	11: 82,115,207		probably benign	Het
Col18a1	A	G	10: 77,085,383	L261P	unknown	Het
Col5a3	T	A	9: 20,775,086		probably null	Het
Cryba4	A	C	5: 112,248,173		probably null	Het
Csf2rb	A	G	15: 78,338,930	Y114C	probably damaging	Het
Ctif	T	C	18: 75,472,016	D484G	probably damaging	Het
Ctnnal1	A	G	4: 56,837,848	F261L	probably damaging	Het
Defb22	A	T	2: 152,486,030	N78K	unknown	Het
Efr3a	G	A	15: 65,837,434		probably null	Het
Elp4	G	T	2: 105,904,481	A3E	probably damaging	Het
Emilin2	A	G	17: 71,273,910	V607A	probably benign	Het
Epsti1	A	G	14: 77,904,490	Y2C	probably damaging	Het
Fam81b	A	C	13: 76,271,293	L46R	probably damaging	Het
Fam81b	G	T	13: 76,271,294	L46I	possibly damaging	Het
Fbxo15	T	A	18: 84,964,153	H288Q	probably damaging	Het
Gabrg1	T	A	5: 70,815,980	N77I	probably damaging	Het
Ganab	A	G	19: 8,912,852	Y715C	possibly damaging	Het
Hist3h2ba	T	C	11: 58,949,276	S113P	possibly damaging	Het
Iqgap2	T	C	13: 95,628,119	D1539G	probably damaging	Het
Kcp	T	C	6: 29,496,517	N633S	probably benign	Het
Krt6a	C	A	15: 101,690,543	S529I	unknown	Het
Leo1	A	G	9: 75,445,562	H129R	probably benign	Het
Lmf1	G	A	17: 25,579,349	V55M	possibly damaging	Het
Mcm9	A	G	10: 53,537,569	S472P	probably benign	Het
Med27	T	A	2: 29,377,938	V33D		Het
Mup15	C	T	4: 61,438,289	E80K	probably benign	Het
Myo18a	G	A	11: 77,859,420	R199H		Het
Nebl	T	A	2: 17,390,916	R558*	probably null	Het
Olfr1121	A	G	2: 87,372,269	T246A	probably damaging	Het
Olfr1252	A	T	2: 89,721,259	I284K	probably damaging	Het
Olfr1329	A	T	4: 118,916,986	H160Q	probably benign	Het
Olfr506	T	C	7: 108,612,991	I228T	probably damaging	Het
Olfr740	G	T	14: 50,453,885	V278L	probably benign	Het
Olfr815	T	C	10: 129,902,353	D119G	probably damaging	Het
Olfr890	A	T	9: 38,143,440	M97L	probably benign	Het
Pde11a	A	T	2: 76,215,353	F376I	possibly damaging	Het
Prima1	A	T	12: 103,235,661	C52S	probably damaging	Het
Pxn	G	A	5: 115,548,547	R366H	not run	Het
Sgce	T	C	6: 4,691,564	Y337C	probably damaging	Het
Slc25a10	T	A	11: 120,495,460	M130K	probably benign	Het
Slc29a2	A	T	19: 5,024,262	N5I	probably benign	Het
Slc5a4a	T	A	10: 76,147,550	V7D	unknown	Het
Stk17b	T	A	1: 53,766,000	D134V	probably damaging	Het
Thbs3	T	A	3: 89,216,707	S36T	probably benign	Het
Thsd4	A	G	9: 60,428,174	S152P	probably benign	Het
Tmem67	G	T	4: 12,063,698	H422N	probably benign	Het
Tram1	C	A	1: 13,589,644	V27F	probably damaging	Het
Trim14	A	G	4: 46,507,238	V326A	possibly damaging	Het

Other mutations in Slc35a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01575:Slc35a1	APN	4	34668932	missense	probably benign	0.09
IGL02185:Slc35a1	APN	4	34675584	missense	probably benign	0.08
PIT4581001:Slc35a1	UTSW	4	34669501	missense	possibly damaging	0.78
R0256:Slc35a1	UTSW	4	34668962	missense	probably benign	0.01
R0271:Slc35a1	UTSW	4	34664125	missense	probably benign	0.00
R1993:Slc35a1	UTSW	4	34675181	missense	probably damaging	0.99
R4583:Slc35a1	UTSW	4	34664146	missense	probably benign
R5259:Slc35a1	UTSW	4	34683322	missense	probably benign	0.14
R5759:Slc35a1	UTSW	4	34675032	missense	probably benign	0.04
R7410:Slc35a1	UTSW	4	34675034	missense	probably benign	0.00
R7663:Slc35a1	UTSW	4	34675493	missense	possibly damaging	0.92
R7785:Slc35a1	UTSW	4	34675148	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GGATGTGACCTTACCCTCGAAC -3'
(R):5'- GATACCCTTCAGTATATGCCTCCTG -3'

Sequencing Primer
(F):5'- TCGAACATTTACAAGTCCATCCTAAG -3'
(R):5'- AGTCCAATCAGCTGAGGTACCTTG -3'

Posted On

2019-11-12