Incidental Mutation 'R7671:Slc35a1'
ID592150
Institutional Source Beutler Lab
Gene Symbol Slc35a1
Ensembl Gene ENSMUSG00000028293
Gene Namesolute carrier family 35 (CMP-sialic acid transporter), member 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7671 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location34663257-34687438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34673875 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 150 (H150Q)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029970]
Predicted Effect probably benign
Transcript: ENSMUST00000029970
SMART Domains Protein: ENSMUSP00000029970
Gene: ENSMUSG00000028293

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 8 314 6.4e-125 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000119125
Gene: ENSMUSG00000028293
AA Change: H150Q

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 1 250 1.2e-86 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the membrane of the Golgi apparatus, where it transports nucleotide sugars into the Golgi. One such nucleotide sugar is CMP-sialic acid, which is imported into the Golgi by the encoded protein and subsequently glycosylated. Defects in this gene are a cause of congenital disorder of glycosylation type 2F (CDG2F). Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous mutation of this gene results in lethality before weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,259,925 I394N probably damaging Het
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
4932438A13Rik T C 3: 36,943,231 F1146L probably damaging Het
4933406M09Rik T C 1: 134,390,062 C191R probably benign Het
Akap13 C A 7: 75,569,900 T17K probably damaging Het
Ankrd29 T A 18: 12,260,986 K257I probably damaging Het
Bicc1 A G 10: 70,957,167 L219P probably benign Het
Boc C T 16: 44,491,849 V617M Het
Ccl8 A G 11: 82,115,207 probably benign Het
Col18a1 A G 10: 77,085,383 L261P unknown Het
Col5a3 T A 9: 20,775,086 probably null Het
Cryba4 A C 5: 112,248,173 probably null Het
Csf2rb A G 15: 78,338,930 Y114C probably damaging Het
Ctif T C 18: 75,472,016 D484G probably damaging Het
Ctnnal1 A G 4: 56,837,848 F261L probably damaging Het
Defb22 A T 2: 152,486,030 N78K unknown Het
Efr3a G A 15: 65,837,434 probably null Het
Elp4 G T 2: 105,904,481 A3E probably damaging Het
Emilin2 A G 17: 71,273,910 V607A probably benign Het
Epsti1 A G 14: 77,904,490 Y2C probably damaging Het
Fam81b A C 13: 76,271,293 L46R probably damaging Het
Fam81b G T 13: 76,271,294 L46I possibly damaging Het
Fbxo15 T A 18: 84,964,153 H288Q probably damaging Het
Gabrg1 T A 5: 70,815,980 N77I probably damaging Het
Ganab A G 19: 8,912,852 Y715C possibly damaging Het
Hist3h2ba T C 11: 58,949,276 S113P possibly damaging Het
Iqgap2 T C 13: 95,628,119 D1539G probably damaging Het
Kcp T C 6: 29,496,517 N633S probably benign Het
Krt6a C A 15: 101,690,543 S529I unknown Het
Leo1 A G 9: 75,445,562 H129R probably benign Het
Lmf1 G A 17: 25,579,349 V55M possibly damaging Het
Mcm9 A G 10: 53,537,569 S472P probably benign Het
Med27 T A 2: 29,377,938 V33D Het
Mup15 C T 4: 61,438,289 E80K probably benign Het
Myo18a G A 11: 77,859,420 R199H Het
Nebl T A 2: 17,390,916 R558* probably null Het
Olfr1121 A G 2: 87,372,269 T246A probably damaging Het
Olfr1252 A T 2: 89,721,259 I284K probably damaging Het
Olfr1329 A T 4: 118,916,986 H160Q probably benign Het
Olfr506 T C 7: 108,612,991 I228T probably damaging Het
Olfr740 G T 14: 50,453,885 V278L probably benign Het
Olfr815 T C 10: 129,902,353 D119G probably damaging Het
Olfr890 A T 9: 38,143,440 M97L probably benign Het
Pde11a A T 2: 76,215,353 F376I possibly damaging Het
Prima1 A T 12: 103,235,661 C52S probably damaging Het
Pxn G A 5: 115,548,547 R366H not run Het
Sgce T C 6: 4,691,564 Y337C probably damaging Het
Slc25a10 T A 11: 120,495,460 M130K probably benign Het
Slc29a2 A T 19: 5,024,262 N5I probably benign Het
Slc5a4a T A 10: 76,147,550 V7D unknown Het
Stk17b T A 1: 53,766,000 D134V probably damaging Het
Thbs3 T A 3: 89,216,707 S36T probably benign Het
Thsd4 A G 9: 60,428,174 S152P probably benign Het
Tmem67 G T 4: 12,063,698 H422N probably benign Het
Tram1 C A 1: 13,589,644 V27F probably damaging Het
Trim14 A G 4: 46,507,238 V326A possibly damaging Het
Other mutations in Slc35a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Slc35a1 APN 4 34668932 missense probably benign 0.09
IGL02185:Slc35a1 APN 4 34675584 missense probably benign 0.08
PIT4581001:Slc35a1 UTSW 4 34669501 missense possibly damaging 0.78
R0256:Slc35a1 UTSW 4 34668962 missense probably benign 0.01
R0271:Slc35a1 UTSW 4 34664125 missense probably benign 0.00
R1993:Slc35a1 UTSW 4 34675181 missense probably damaging 0.99
R4583:Slc35a1 UTSW 4 34664146 missense probably benign
R5259:Slc35a1 UTSW 4 34683322 missense probably benign 0.14
R5759:Slc35a1 UTSW 4 34675032 missense probably benign 0.04
R7410:Slc35a1 UTSW 4 34675034 missense probably benign 0.00
R7663:Slc35a1 UTSW 4 34675493 missense possibly damaging 0.92
R7785:Slc35a1 UTSW 4 34675148 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGATGTGACCTTACCCTCGAAC -3'
(R):5'- GATACCCTTCAGTATATGCCTCCTG -3'

Sequencing Primer
(F):5'- TCGAACATTTACAAGTCCATCCTAAG -3'
(R):5'- AGTCCAATCAGCTGAGGTACCTTG -3'
Posted On2019-11-12